Transcript: Mouse NM_001168281.1

Mus musculus WW domain containing transcription regulator 1 (Wwtr1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Wwtr1 (97064)
Length:
4688
CDS:
31..1389

Additional Resources:

NCBI RefSeq record:
NM_001168281.1
NBCI Gene record:
Wwtr1 (97064)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095951 CAGCCGAATCTCGCAATGAAT pLKO.1 757 CDS 100% 5.625 7.875 N Wwtr1 n/a
2 TRCN0000325143 CAGCCGAATCTCGCAATGAAT pLKO_005 757 CDS 100% 5.625 7.875 N Wwtr1 n/a
3 TRCN0000095950 CCTTCTTTAAGGAGCCCGATT pLKO.1 353 CDS 100% 4.050 3.240 N Wwtr1 n/a
4 TRCN0000325142 CCTTCTTTAAGGAGCCCGATT pLKO_005 353 CDS 100% 4.050 3.240 N Wwtr1 n/a
5 TRCN0000095949 CCTGCATTTCTGTGGCAGATA pLKO.1 1602 3UTR 100% 4.950 3.465 N Wwtr1 n/a
6 TRCN0000095952 GTGATGAATCAGCCTCTGAAT pLKO.1 673 CDS 100% 4.950 3.465 N Wwtr1 n/a
7 TRCN0000325224 GTGATGAATCAGCCTCTGAAT pLKO_005 673 CDS 100% 4.950 3.465 N Wwtr1 n/a
8 TRCN0000019472 GCCCTTTCTAACCTGGCTGTA pLKO.1 1368 CDS 100% 4.050 2.835 N WWTR1 n/a
9 TRCN0000095953 CCATGAGCACAGATATGAGAT pLKO.1 1034 CDS 100% 4.950 2.970 N Wwtr1 n/a
10 TRCN0000325144 CCATGAGCACAGATATGAGAT pLKO_005 1034 CDS 100% 4.950 2.970 N Wwtr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02889 pDONR223 100% 77.2% 79.8% None (many diffs) n/a
2 ccsbBroad304_02889 pLX_304 44.7% 77.2% 79.8% V5 (many diffs) n/a
3 TRCN0000472318 CATTTTATCCGAAACCGGTTGTGA pLX_317 40.4% 77.2% 79.8% V5 (many diffs) n/a
4 TRCN0000488989 TCGTCCAGGGCTAAACAGCTGTCG pLX_317 25.3% 77.2% 79.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV