Transcript: Mouse NM_001168333.1

Mus musculus tubulointerstitial nephritis antigen-like 1 (Tinagl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tinagl1 (94242)
Length:
1954
CDS:
89..1489

Additional Resources:

NCBI RefSeq record:
NM_001168333.1
NBCI Gene record:
Tinagl1 (94242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030663 TCAGGTTGATTCCAACGACAT pLKO.1 1075 CDS 100% 4.050 5.670 N Tinagl1 n/a
2 TRCN0000308840 TCAGGTTGATTCCAACGACAT pLKO_005 1075 CDS 100% 4.050 5.670 N Tinagl1 n/a
3 TRCN0000030659 CCCAGACATGATTAAAGCCAT pLKO.1 514 CDS 100% 2.640 3.696 N Tinagl1 n/a
4 TRCN0000308900 CCCAGACATGATTAAAGCCAT pLKO_005 514 CDS 100% 2.640 3.696 N Tinagl1 n/a
5 TRCN0000030661 GACACATGACACCCATCCTAT pLKO.1 828 CDS 100% 4.950 3.465 N Tinagl1 n/a
6 TRCN0000308837 GACACATGACACCCATCCTAT pLKO_005 828 CDS 100% 4.950 3.465 N Tinagl1 n/a
7 TRCN0000030662 CACCTGTTACTGTGACCTCTT pLKO.1 292 CDS 100% 4.050 2.835 N Tinagl1 n/a
8 TRCN0000308839 CACCTGTTACTGTGACCTCTT pLKO_005 292 CDS 100% 4.050 2.835 N Tinagl1 n/a
9 TRCN0000030660 CCTGTTCAAGCACTCATGGAA pLKO.1 1169 CDS 100% 3.000 2.100 N Tinagl1 n/a
10 TRCN0000308838 CCTGTTCAAGCACTCATGGAA pLKO_005 1169 CDS 100% 3.000 2.100 N Tinagl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03929 pDONR223 100% 84.5% 89% None (many diffs) n/a
2 ccsbBroad304_03929 pLX_304 0% 84.5% 89% V5 (many diffs) n/a
3 TRCN0000467670 AGTGTACCCACATTATCACCTCTT pLX_317 21.9% 84.5% 89% V5 (many diffs) n/a
4 ccsbBroadEn_15964 pDONR223 0% 39.6% 41.4% None (many diffs) n/a
5 ccsbBroad304_15964 pLX_304 0% 39.6% 41.4% V5 (many diffs) n/a
Download CSV