Transcript: Human NM_001168338.1

Homo sapiens plasminogen (PLG), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
PLG (5340)
Length:
1200
CDS:
113..523

Additional Resources:

NCBI RefSeq record:
NM_001168338.1
NBCI Gene record:
PLG (5340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255923 ACCTGCAGGGCATTCCAATAT pLKO_005 290 CDS 100% 13.200 6.600 Y PLGLB1 n/a
2 TRCN0000255924 GAGCAACAATGTGTGATAATG pLKO_005 320 CDS 100% 13.200 6.600 Y PLGLB1 n/a
3 TRCN0000118253 GCATTCCAATATCACAGTAAA pLKO.1 299 CDS 100% 13.200 6.600 Y PLGLB2 n/a
4 TRCN0000118252 GCCAACTGTATTTAGGATAAT pLKO.1 849 3UTR 100% 13.200 6.600 Y PLGLB2 n/a
5 TRCN0000255926 GGAAGTCCTCCATAATCATTA pLKO_005 351 CDS 100% 13.200 6.600 Y PLGLB1 n/a
6 TRCN0000427309 AGCAACAATGTGTGATAATGG pLKO_005 321 CDS 100% 4.950 2.475 Y PLGLB2 n/a
7 TRCN0000178840 CTTCACTGTTCAGTGTCACTA pLKO.1 204 CDS 100% 4.950 2.475 Y PLGLB1 n/a
8 TRCN0000183040 CAATGTGTGATAATGGCTGAA pLKO.1 326 CDS 100% 4.050 2.025 Y PLGLB1 n/a
9 TRCN0000118256 GTCCTCCATAATCATTAGGAT pLKO.1 355 CDS 100% 3.000 1.500 Y PLGLB2 n/a
10 TRCN0000419153 ATGCTTCTCAAGTCCCTTATG pLKO_005 619 3UTR 100% 10.800 5.400 Y PLGLB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01217 pDONR223 100% 68.6% 67.6% None (many diffs) n/a
2 ccsbBroad304_01217 pLX_304 0% 68.6% 67.6% V5 (many diffs) n/a
3 TRCN0000471881 CTAGCATCATGTCTTCGTAACTGC pLX_317 100% 68.6% 67.6% V5 (many diffs) n/a
4 ccsbBroadEn_06737 pDONR223 100% 16.7% 16.7% None 408_408delGins2023 n/a
5 ccsbBroad304_06737 pLX_304 0% 16.7% 16.7% V5 408_408delGins2023 n/a
6 TRCN0000475970 TCACACCATCCTGCAGCGGTAGCC pLX_317 15.4% 16.7% 16.7% V5 408_408delGins2023 n/a
Download CSV