Transcript: Mouse NM_001168492.1

Mus musculus programmed cell death 4 (Pdcd4), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pdcd4 (18569)
Length:
1806
CDS:
203..1612

Additional Resources:

NCBI RefSeq record:
NM_001168492.1
NBCI Gene record:
Pdcd4 (18569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374004 ATTTCCGCATCTACTATTAAT pLKO_005 335 CDS 100% 15.000 21.000 N Pdcd4 n/a
2 TRCN0000321219 AGACTCTAACACCAATTATAC pLKO_005 699 CDS 100% 13.200 18.480 N Pdcd4 n/a
3 TRCN0000321156 GGAACTGGAAGTACCTCATTT pLKO_005 1258 CDS 100% 13.200 18.480 N Pdcd4 n/a
4 TRCN0000435341 GGAACTGGAAGTACCTCATTT pLKO_005 1258 CDS 100% 13.200 18.480 N PDCD4 n/a
5 TRCN0000012139 GCGGAGATGTTAAGAGACTTA pLKO.1 755 CDS 100% 4.950 6.930 N Pdcd4 n/a
6 TRCN0000012141 CCTGTCAATCACCTTGTTAAA pLKO.1 1169 CDS 100% 13.200 9.240 N Pdcd4 n/a
7 TRCN0000321218 CCTGTCAATCACCTTGTTAAA pLKO_005 1169 CDS 100% 13.200 9.240 N Pdcd4 n/a
8 TRCN0000374006 TCTTACAGTCTTAGGTGTTAC pLKO_005 1623 3UTR 100% 10.800 7.560 N Pdcd4 n/a
9 TRCN0000012142 CGAGCTTGTATATGAAGCCAT pLKO.1 1285 CDS 100% 2.640 1.848 N Pdcd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14123 pDONR223 100% 89.3% 95.7% None (many diffs) n/a
2 ccsbBroad304_14123 pLX_304 0% 89.3% 95.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472554 GTTACTACCGTATGTCTCAGGCAA pLX_317 31.6% 89.3% 95.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV