Transcript: Human NM_001170781.2

Homo sapiens family with sequence similarity 122C (FAM122C), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM122C (159091)
Length:
2469
CDS:
363..659

Additional Resources:

NCBI RefSeq record:
NM_001170781.2
NBCI Gene record:
FAM122C (159091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 705 3UTR 100% 1.080 0.540 Y GPR83 n/a
2 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 705 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16111 pDONR223 0% 59.2% 40.3% None (many diffs) n/a
2 ccsbBroad304_16111 pLX_304 0% 59.2% 40.3% V5 (many diffs) n/a
3 TRCN0000467347 CTTACCCTTGAAAATGTTCACGCA pLX_317 23.7% 59.2% 40.3% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 49.8% 21.3% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 49.8% 21.3% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 49.8% 21.3% V5 (many diffs) n/a
7 ccsbBroadEn_10792 pDONR223 100% 44.3% 3.7% None (many diffs) n/a
8 ccsbBroad304_10792 pLX_304 0% 44.3% 3.7% V5 (many diffs) n/a
9 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 44.3% 3.7% V5 (many diffs) n/a
Download CSV