Transcript: Human NM_001170803.2

Homo sapiens La ribonucleoprotein 4 (LARP4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-29
Taxon:
Homo sapiens (human)
Gene:
LARP4 (113251)
Length:
6015
CDS:
127..1875

Additional Resources:

NCBI RefSeq record:
NM_001170803.2
NBCI Gene record:
LARP4 (113251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275017 CAAGGGCTAGTAAGGATTATT pLKO_005 1709 CDS 100% 15.000 21.000 N LARP4 n/a
2 TRCN0000160140 CCAAGTCATAAGCGTTGTATT pLKO.1 706 CDS 100% 13.200 18.480 N LARP4 n/a
3 TRCN0000275019 CCAAGTCATAAGCGTTGTATT pLKO_005 706 CDS 100% 13.200 18.480 N LARP4 n/a
4 TRCN0000161967 GCACACAATAGCAACTGGTAT pLKO.1 823 CDS 100% 4.950 6.930 N LARP4 n/a
5 TRCN0000164286 CCTGAGAACTCCGTTGAGAAA pLKO.1 1669 CDS 100% 4.950 3.960 N LARP4 n/a
6 TRCN0000274949 CCTGAGAACTCCGTTGAGAAA pLKO_005 1669 CDS 100% 4.950 3.960 N LARP4 n/a
7 TRCN0000164215 CCCAATTTGGACAGTTGCCAA pLKO.1 582 CDS 100% 2.640 2.112 N LARP4 n/a
8 TRCN0000274951 TAATTCGCCAGGATCTTATAA pLKO_005 966 CDS 100% 15.000 10.500 N LARP4 n/a
9 TRCN0000275018 ACTTGAACTGTGGCTATATTG pLKO_005 1919 3UTR 100% 13.200 9.240 N LARP4 n/a
10 TRCN0000160572 CCTTTGAAATTCACCTGATTA pLKO.1 5570 3UTR 100% 13.200 9.240 N LARP4 n/a
11 TRCN0000159791 GCGTTGGATTTCAGAGAATAA pLKO.1 3950 3UTR 100% 13.200 9.240 N LARP4 n/a
12 TRCN0000159319 GCCTCATTACATCTAATAGTT pLKO.1 4276 3UTR 100% 5.625 3.938 N LARP4 n/a
13 TRCN0000161048 GCTTTAATTCGCCAGGATCTT pLKO.1 962 CDS 100% 4.950 3.465 N LARP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13020 pDONR223 100% 46.3% 46% None (many diffs) n/a
2 ccsbBroad304_13020 pLX_304 0% 46.3% 46% V5 (many diffs) n/a
3 TRCN0000467269 GATAATGCTGATCCTGAGGGTGGA pLX_317 40.6% 46.3% 46% V5 (many diffs) n/a
4 ccsbBroadEn_13021 pDONR223 100% 32.3% 31.4% None 1_210del;757_758delAA;777_1746del n/a
5 ccsbBroad304_13021 pLX_304 0% 32.3% 31.4% V5 1_210del;757_758delAA;777_1746del n/a
6 TRCN0000479126 CATTTTTATGGCAGGAAGATCATG pLX_317 73.6% 32.3% 31.4% V5 1_210del;757_758delAA;777_1746del n/a
Download CSV