Transcript: Human NM_001171095.1

Homo sapiens claudin 2 (CLDN2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CLDN2 (9075)
Length:
2932
CDS:
289..981

Additional Resources:

NCBI RefSeq record:
NM_001171095.1
NBCI Gene record:
CLDN2 (9075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108446 CCAGAGAAATCGCTCCAACTA pLKO.1 849 CDS 100% 4.950 3.960 N CLDN2 n/a
2 TRCN0000108447 GCTCTTTACTTGGGCATTATT pLKO.1 775 CDS 100% 15.000 10.500 N CLDN2 n/a
3 TRCN0000433252 ACAGCATGAAATTTGAGATTG pLKO_005 749 CDS 100% 10.800 7.560 N CLDN2 n/a
4 TRCN0000422124 GATTGAGCAAAGGCAGAAATG pLKO_005 1119 3UTR 100% 10.800 7.560 N CLDN2 n/a
5 TRCN0000415862 AGGACTCAGAGGATCCCTTTG pLKO_005 1272 3UTR 100% 6.000 4.200 N CLDN2 n/a
6 TRCN0000108449 CAAAGTCAAGAGTGAGTTCAA pLKO.1 933 CDS 100% 4.950 3.465 N CLDN2 n/a
7 TRCN0000108445 CCAGACTAATTTGTGCATGAA pLKO.1 1530 3UTR 100% 4.950 3.465 N CLDN2 n/a
8 TRCN0000108448 GATGGTGACATCCAGTGCAAT pLKO.1 537 CDS 100% 4.950 3.465 N CLDN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14013 pDONR223 100% 99.8% 3.4% None 13delG n/a
2 ccsbBroad304_14013 pLX_304 0% 99.8% 3.4% V5 (not translated due to prior stop codon) 13delG n/a
3 TRCN0000471958 TAAAAAGCCTGGGATATAAAGATA pLX_317 60.7% 99.8% 3.4% V5 (not translated due to prior stop codon) 13delG n/a
Download CSV