Transcript: Human NM_001171156.2

Homo sapiens sialic acid binding Ig like lectin 10 (SIGLEC10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SIGLEC10 (89790)
Length:
3060
CDS:
62..1981

Additional Resources:

NCBI RefSeq record:
NM_001171156.2
NBCI Gene record:
SIGLEC10 (89790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151613 GAACGATGGGTTCTTTCTAAA pLKO.1 454 CDS 100% 13.200 9.240 N SIGLEC10 n/a
2 TRCN0000154244 CGGATTATGCAGAAGTCAAGT pLKO.1 1953 CDS 100% 4.950 3.465 N SIGLEC10 n/a
3 TRCN0000152772 GAACCCAAATCATCCACTCAA pLKO.1 1829 CDS 100% 4.950 3.465 N SIGLEC10 n/a
4 TRCN0000153585 GAATCAGAAAGCCACACCAAA pLKO.1 1720 CDS 100% 4.950 3.465 N SIGLEC10 n/a
5 TRCN0000153362 GAGAGGAAGCTATGTGAGATA pLKO.1 424 CDS 100% 4.950 3.465 N SIGLEC10 n/a
6 TRCN0000157666 GCTCAGAAGCGGAATCAGAAA pLKO.1 1709 CDS 100% 4.950 3.465 N SIGLEC10 n/a
7 TRCN0000157463 GCTACTGGTTCAAAGCAGTGA pLKO.1 234 CDS 100% 2.640 1.848 N SIGLEC10 n/a
8 TRCN0000150996 CGTACAAGATACAGGTCATAA pLKO.1 2718 3UTR 100% 13.200 7.920 N SIGLEC10 n/a
9 TRCN0000153586 GCAGTAAAGAAGCCAACCAAA pLKO.1 2762 3UTR 100% 4.950 2.970 N SIGLEC10 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2151 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000158034 CTGAGAGTGATGGTTTCCCAA pLKO.1 926 CDS 100% 2.640 1.320 Y SIGLEC10 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2152 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09273 pDONR223 100% 91.5% 91.5% None 144G>A;418_419ins174;503C>T n/a
2 ccsbBroad304_09273 pLX_304 0% 91.5% 91.5% V5 144G>A;418_419ins174;503C>T n/a
3 TRCN0000481318 CTTGAACAGTGTGCCTTCGGTTGG pLX_317 19.4% 91.5% 91.5% V5 144G>A;418_419ins174;503C>T n/a
Download CSV