Transcript: Human NM_001171820.1

Homo sapiens peroxisome proliferator activated receptor delta (PPARD), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PPARD (5467)
Length:
3455
CDS:
310..1341

Additional Resources:

NCBI RefSeq record:
NM_001171820.1
NBCI Gene record:
PPARD (5467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338385 ATCCACGACATCGAGACATTG pLKO_005 652 CDS 100% 10.800 15.120 N PPARD n/a
2 TRCN0000001664 CCGCAAACCCTTCAGTGATAT pLKO.1 975 CDS 100% 13.200 9.240 N PPARD n/a
3 TRCN0000338383 CCGCAAACCCTTCAGTGATAT pLKO_005 975 CDS 100% 13.200 9.240 N PPARD n/a
4 TRCN0000338384 TATTCATTGCGGCCATCATTC pLKO_005 1064 CDS 100% 10.800 7.560 N PPARD n/a
5 TRCN0000001662 CCTATTCATTGCGGCCATCAT pLKO.1 1062 CDS 100% 4.950 3.465 N PPARD n/a
6 TRCN0000001661 GTATTATTTCACCAGCAGCAT pLKO.1 1700 3UTR 100% 2.640 1.848 N PPARD n/a
7 TRCN0000350911 GTATTATTTCACCAGCAGCAT pLKO_005 1700 3UTR 100% 2.640 1.848 N PPARD n/a
8 TRCN0000001663 GATCAAGAAGACCGAAACCGA pLKO.1 1272 CDS 100% 0.750 0.525 N PPARD n/a
9 TRCN0000010647 GTGTGGAAGCAGTTGGTGAAT pLKO.1 694 CDS 100% 4.950 2.970 N PPARD n/a
10 TRCN0000350974 GTGTGGAAGCAGTTGGTGAAT pLKO_005 694 CDS 100% 4.950 2.970 N PPARD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488417 ATGCTCAACAGCCAACGAACTGGC pLX_317 28.9% 59.4% 59.1% V5 (many diffs) n/a
2 ccsbBroadEn_06754 pDONR223 100% 59.4% 59.1% None (many diffs) n/a
3 ccsbBroad304_06754 pLX_304 0% 59.4% 59.1% V5 (many diffs) n/a
4 TRCN0000470421 CTCTATGCCAAACTACCAATACAT pLX_317 35% 59.4% 59.1% V5 (many diffs) n/a
5 TRCN0000488494 TCCCTACTTCATCTTTCGAAAGCC pLX_317 20.4% 59.4% 59.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV