Transcript: Human NM_001172645.1

Homo sapiens thymidine kinase 2 (TK2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TK2 (7084)
Length:
5060
CDS:
352..1095

Additional Resources:

NCBI RefSeq record:
NM_001172645.1
NBCI Gene record:
TK2 (7084)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149097 TAGCGTAAGACCCCAGCGAG pXPR_003 AGG 256 34% 4 0.7076 TK2 TK2 77299
2 BRDN0001144837 ACGAGTATGCCTGTCCAGCA pXPR_003 TGG 298 40% 4 0.6846 TK2 TK2 77297
3 BRDN0001146931 ATCCTGAGACTTGTTACCAG pXPR_003 AGG 516 69% 7 0.1545 TK2 TK2 77298
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172645.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219751 TCGATTCACAGCGCAAGATAC pLKO.1 700 CDS 100% 10.800 15.120 N TK2 n/a
2 TRCN0000219750 ATCTGTGTCGAGGGCAATATT pLKO.1 508 CDS 100% 15.000 10.500 N TK2 n/a
3 TRCN0000219752 GTCTGTTGATTTGATAGTTTA pLKO.1 819 CDS 100% 13.200 9.240 N TK2 n/a
4 TRCN0000006392 CCTGTATAGAAGTGGGAAGAT pLKO.1 735 CDS 100% 4.950 3.465 N TK2 n/a
5 TRCN0000338423 CCTGTATAGAAGTGGGAAGAT pLKO_005 735 CDS 100% 4.950 3.465 N TK2 n/a
6 TRCN0000011017 GAGACTTGTTACCAGAGGTTA pLKO.1 856 CDS 100% 4.950 3.465 N TK2 n/a
7 TRCN0000350914 GAGACTTGTTACCAGAGGTTA pLKO_005 856 CDS 100% 4.950 3.465 N TK2 n/a
8 TRCN0000197174 GCTGTAAATAGAGGTAGCAAG pLKO.1 2440 3UTR 100% 4.050 2.835 N TK2 n/a
9 TRCN0000011015 CCACATCTTCATGTGGACATT pLKO.1 1829 3UTR 100% 0.495 0.347 N TK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172645.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07070 pDONR223 100% 80.2% 80.1% None (many diffs) n/a
2 ccsbBroad304_07070 pLX_304 0% 80.2% 80.1% V5 (many diffs) n/a
3 TRCN0000489689 AGCACTGAAGATCATTCCGTGCGT pLX_317 56.4% 78.7% 78.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_11189 pDONR223 100% 74.3% 73.2% None (many diffs) n/a
5 ccsbBroad304_11189 pLX_304 0% 74.3% 73.2% V5 (many diffs) n/a
6 TRCN0000480376 CTCTATCCCCGCCTGTTCGCGTGC pLX_317 64.8% 74.3% 73.2% V5 (many diffs) n/a
Download CSV