Transcript: Human NM_001172674.1

Homo sapiens zinc finger protein 347 (ZNF347), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
ZNF347 (84671)
Length:
4565
CDS:
428..2950

Additional Resources:

NCBI RefSeq record:
NM_001172674.1
NBCI Gene record:
ZNF347 (84671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420098 TAACGTGTGGAAAGTTCTAAA pLKO_005 2890 CDS 100% 13.200 18.480 N ZNF347 n/a
2 TRCN0000016553 GCCTAGCTATTCATCTGGTAA pLKO.1 1758 CDS 100% 4.950 6.930 N ZNF347 n/a
3 TRCN0000435097 AGACATCCAAGAGTCCATAAT pLKO_005 3400 3UTR 100% 13.200 9.240 N ZNF347 n/a
4 TRCN0000415386 GCAAGGTCTTTAGGCGTAATT pLKO_005 1818 CDS 100% 13.200 9.240 N ZNF347 n/a
5 TRCN0000016556 CCAAGTACAAATAGCAGGAAA pLKO.1 643 CDS 100% 4.950 3.465 N ZNF347 n/a
6 TRCN0000016557 CCTTGTAAGACATCGAGGAAT pLKO.1 1507 CDS 100% 4.950 3.465 N ZNF347 n/a
7 TRCN0000016555 GAGAGTTCATACTGGAGGTAA pLKO.1 2446 CDS 100% 4.950 3.465 N ZNF347 n/a
8 TRCN0000016554 CCTCAGTATTATCTCTATGTT pLKO.1 589 CDS 100% 5.625 3.375 N ZNF347 n/a
9 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 1448 CDS 100% 15.000 7.500 Y Gm10771 n/a
10 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 1448 CDS 100% 15.000 7.500 Y ZNF286B n/a
11 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 1627 CDS 100% 10.800 5.400 Y Rex2 n/a
12 TRCN0000151709 CAAATGTAATGAGTGTGGCAA pLKO.1 2137 CDS 100% 2.640 1.320 Y ZNF320 n/a
13 TRCN0000150214 GTAATGAATGTGGCAAGGTTT pLKO.1 1638 CDS 100% 4.950 2.475 Y ZNF813 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14339 pDONR223 100% 5.7% .3% None (many diffs) n/a
2 ccsbBroad304_14339 pLX_304 0% 5.7% .3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 5.7% .3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV