Construct: ORF TRCN0000471065
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012324.1_s317c1
- Derived from:
- ccsbBroadEn_08646
- DNA Barcode:
- TGGCACCATTAGATCTGCTGCTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMPRSS4 (56649)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471065
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_019894.4 | 99.7% | 99.5% | 18C>G;623T>G;1215T>C |
| 2 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001173551.1 | 99.3% | 99% | 2_3insGTTACA;12C>G;1209T>C |
| 3 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001083947.1 | 98.7% | 98.6% | 18C>G;437_438insCAGCAAACCCACTTT;1200T>C |
| 4 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001290094.1 | 94.2% | 94.2% | 0_1ins75;1140T>C |
| 5 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001173552.1 | 90.6% | 90.1% | (many diffs) |
| 6 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_005271613.4 | 88.1% | 87.4% | (many diffs) |
| 7 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_005271614.3 | 87.7% | 86.8% | (many diffs) |
| 8 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_011542901.2 | 87.1% | 86.4% | (many diffs) |
| 9 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_011542902.2 | 80.4% | 79.5% | (many diffs) |
| 10 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_005271615.3 | 80% | 78.9% | (many diffs) |
| 11 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_011542903.3 | 73.9% | 71.3% | (many diffs) |
| 12 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001290096.1 | 66.2% | 66.3% | 0_1ins426;11_12insCAGCAAACCCACTTT;774T>C |
| 13 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_011542904.2 | 52% | 44.8% | (many diffs) |
| 14 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NR_110734.1 | 32.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1377
- ORF length:
- 1311
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt acaggatcct gagagtgatc aacctctgaa cagcctcgat gtcaaacccc 121 tgcgcaaacc ccgtatcccc atggagacct tcagaaaggt ggggatcccc atcatcatag 181 cactactgag cctggcgagt atcatcattg tggttgtcct catcaaggtg attctggata 241 aatactactt cctctgcggg cagcctctcc acttcatccc gaggaagcag ctgtgtgacg 301 gagagctgga ctgtcccttg ggggaggacg aggagcactg tgtcaagagc ttccccgaag 361 ggcctgcagt ggcagtccgc ctctccaagg accgatccac actgcaggtg ctggactcgg 421 ccacagggaa ctggttctct gcctgtttcg acaacttcac agaagctctc gctgagacag 481 cctgtaggca gatgggctac agcagcaaac ccactttcag agctgtggag attggcccag 541 accaggatct ggatgttgtt gaaatcacag aaaacagcca ggagcttcgc atgcggaact 601 caagtgggcc ctgtctctca ggctccctgg tctccctgca ctgtcttgcc tgtgggaaga 661 gcctgaagac cccccgtgtg gtgggtgggg aggaggcctc tgtggattct tggccttggc 721 aggtcagcat ccagtacgac aaacagcacg tctgtggagg gagcatcctg gacccccact 781 gggtcctcac ggcagcccac tgcttcagga aacataccga tgtgttcaac tggaaggtgc 841 gggcaggctc agacaaactg ggCAGCTTCC CATCCCTGGC TGTGGCCAAG ATCATCATCA 901 TTGAATTCAA CCCCATGTAC CCCAAAGACA ATGACATCGC CCTCATGAAG CTGCAGTTCC 961 CACTCACTTT CTCAGGCACA GTCAGGCCCA TCTGTCTGCC CTTCTTTGAT GAGGAGCTCA 1021 CTCCAGCCAC CCCACTCTGG ATCATTGGAT GGGGCTTTAC GAAGCAGAAT GGAGGGAAGA 1081 TGTCTGACAT ACTGCTGCAG GCGTCAGTCC AGGTCATTGA CAGCACACGG TGCAATGCAG 1141 ACGATGCGTA CCAGGGGGAA GTCACCGAGA AGATGATGTG TGCAGGCATC CCGGAAGGGG 1201 GTGTGGACAC CTGCCAGGGT GACAGTGGTG GGCCCCTGAT GTACCAATCT GACCAGTGGC 1261 ATGTGGTGGG CATCGTTAGC TGGGGCTATG GCTGCGGGGG CCCGAGCACC CCAGGAGTAT 1321 ACACCAAGGT CTCAGCCTAT CTCAACTGGA TCTACAATGT CTGGAAGGCT GAGCTGTACC 1381 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1441 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1501 ATATATCTTG TGGAAAGGAC GATGGCACCA TTAGATCTGC TGCTTTACGC GTTAAGTCga 1561 caatcaacct ctggattaca aaatttgtga aagatt