Transcript: Human NM_001174120.1

Homo sapiens zinc finger FYVE-type containing 27 (ZFYVE27), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ZFYVE27 (118813)
Length:
2776
CDS:
203..1159

Additional Resources:

NCBI RefSeq record:
NM_001174120.1
NBCI Gene record:
ZFYVE27 (118813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001174120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136870 CCCTGCCTTTCTCAAGTATTT pLKO.1 2297 3UTR 100% 13.200 9.240 N ZFYVE27 n/a
2 TRCN0000136788 CAACTTGGTTCTCTCCTACAA pLKO.1 316 CDS 100% 4.950 3.465 N ZFYVE27 n/a
3 TRCN0000134203 CCAACAGTTTCATGTTCACTA pLKO.1 2201 3UTR 100% 4.950 3.465 N ZFYVE27 n/a
4 TRCN0000137404 GCTTCTAGAAACAGGGTTGAA pLKO.1 1728 3UTR 100% 4.950 3.465 N ZFYVE27 n/a
5 TRCN0000137819 GAAACAGCTTCTGCTCTCGAT pLKO.1 1032 CDS 100% 2.640 1.848 N ZFYVE27 n/a
6 TRCN0000138667 GTGTAACCAGACCTTGAGCAA pLKO.1 1135 CDS 100% 2.640 1.848 N ZFYVE27 n/a
7 TRCN0000138586 CTTCCGAGTTGTGTCTGAGTA pLKO.1 601 CDS 100% 4.950 2.970 N ZFYVE27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13072 pDONR223 100% 80.9% 74.1% None (many diffs) n/a
2 ccsbBroad304_13072 pLX_304 0% 80.9% 74.1% V5 (many diffs) n/a
3 TRCN0000473164 ACTATGTATCCCCCATGCCTCGCG pLX_317 41.5% 80.9% 74.1% V5 (many diffs) n/a
Download CSV