Transcript: Mouse NM_001177573.1

Mus musculus expressed sequence BB287469 (BB287469), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
BB287469 (544881)
Length:
1851
CDS:
496..930

Additional Resources:

NCBI RefSeq record:
NM_001177573.1
NBCI Gene record:
BB287469 (544881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256191 TAAGGAGGCTGTGCCACATAA pLKO_005 659 CDS 100% 13.200 6.600 Y Gm2016 n/a
2 TRCN0000270258 CCTCAGACATTATATTGATTG pLKO_005 713 CDS 100% 10.800 5.400 Y Gm5662 n/a
3 TRCN0000256192 CATTATATTGATTGGTCTAAG pLKO_005 720 CDS 100% 10.800 5.400 Y Gm2016 n/a
4 TRCN0000127030 CGAGACTATCAAGATAACAAA pLKO.1 739 CDS 100% 5.625 2.813 Y Eif1a n/a
5 TRCN0000334581 CGAGACTATCAAGATAACAAA pLKO_005 739 CDS 100% 5.625 2.813 Y Eif1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02077 pDONR223 100% 88.4% 89.5% None (many diffs) n/a
2 ccsbBroad304_02077 pLX_304 0% 88.4% 89.5% V5 (many diffs) n/a
3 TRCN0000466671 CTTCCACCAGTTATAATCCAACTC pLX_317 57.7% 88.4% 89.5% V5 (many diffs) n/a
4 ccsbBroadEn_06145 pDONR223 100% 84.9% 89.5% None (many diffs) n/a
5 ccsbBroad304_06145 pLX_304 0% 84.9% 89.5% V5 (many diffs) n/a
6 TRCN0000475064 CCTGTTCTTTCTGAACACCACATC pLX_317 100% 84.9% 89.5% V5 (many diffs) n/a
Download CSV