Transcript: Human NM_001178063.2

Homo sapiens complement C2 (C2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
C2 (717)
Length:
2012
CDS:
69..1685

Additional Resources:

NCBI RefSeq record:
NM_001178063.2
NBCI Gene record:
C2 (717)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001178063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003490 GCATGTCACTATTAAGCCCAA pLKO.1 866 CDS 100% 2.160 3.024 N C2 n/a
2 TRCN0000371537 TAACACCTATGCGGCCTTAAA pLKO_005 437 CDS 100% 13.200 9.240 N C2 n/a
3 TRCN0000003491 CCAACCCTACTCTTATGACTT pLKO.1 314 CDS 100% 4.950 3.465 N C2 n/a
4 TRCN0000003489 GACTCATGCTTGTTTCACTTT pLKO.1 1930 3UTR 100% 4.950 3.465 N C2 n/a
5 TRCN0000003487 GCCACGAGACTTTCACATCAA pLKO.1 1598 CDS 100% 4.950 3.465 N C2 n/a
6 TRCN0000371474 GACAGATGGAAAGTCCAATAT pLKO_005 548 CDS 100% 13.200 7.920 N C2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001178063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00184 pDONR223 100% 69.4% 68.1% None (many diffs) n/a
2 ccsbBroad304_00184 pLX_304 0% 69.4% 68.1% V5 (many diffs) n/a
3 TRCN0000477131 CATACACCTCACTTATGATTTCAA pLX_317 16.8% 69.4% 68.1% V5 (many diffs) n/a
Download CSV