Transcript: Human NM_001184819.2

Homo sapiens G protein nucleolar 3 like (GNL3L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
GNL3L (54552)
Length:
8684
CDS:
249..1997

Additional Resources:

NCBI RefSeq record:
NM_001184819.2
NBCI Gene record:
GNL3L (54552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163079 GAGACCCATTACCACCGTTAA pLKO.1 3950 3UTR 100% 10.800 8.640 N GNL3L n/a
2 TRCN0000160382 CGTGTATAAGATTGGAGATCT pLKO.1 1685 CDS 100% 4.950 3.960 N GNL3L n/a
3 TRCN0000164381 CGGAGAATCTGATGAGCTGTT pLKO.1 1577 CDS 100% 4.050 3.240 N GNL3L n/a
4 TRCN0000230262 AGAAGAAGGGAGGCTTATATA pLKO_005 1366 CDS 100% 15.000 10.500 N GNL3L n/a
5 TRCN0000218409 CAATCGAGAGGCTGAATTAAA pLKO_005 407 CDS 100% 15.000 10.500 N GNL3L n/a
6 TRCN0000230263 CCACTACCACAATCGAAATAT pLKO_005 5387 3UTR 100% 15.000 10.500 N GNL3L n/a
7 TRCN0000163456 GCCAATCGAGAGGCTGAATTA pLKO.1 405 CDS 100% 13.200 9.240 N GNL3L n/a
8 TRCN0000230260 GCCACGAGGAAGGCTTATTAC pLKO_005 603 CDS 100% 13.200 9.240 N GNL3L n/a
9 TRCN0000230261 GGAGGAGATTTCCAACTATTA pLKO_005 1280 CDS 100% 13.200 9.240 N GNL3L n/a
10 TRCN0000161846 GTCCTGGTCTTGAACAAGATT pLKO.1 753 CDS 100% 5.625 3.938 N GNL3L n/a
11 TRCN0000162107 CAAGAAGATAAGTTGGCCCTA pLKO.1 302 CDS 100% 2.160 1.512 N GNL3L n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6058 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000162985 GAGACAAGGTTTCACCATGTT pLKO.1 7400 3UTR 100% 4.950 2.475 Y LINC00336 n/a
14 TRCN0000140238 GTCTCCCAAAGTGCTAGGATT pLKO.1 6983 3UTR 100% 4.950 2.475 Y PDZD7 n/a
15 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4955 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4955 3UTR 100% 4.050 2.025 Y ORAI2 n/a
17 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4955 3UTR 100% 4.050 2.025 Y P3H4 n/a
18 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 7470 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
19 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 7470 3UTR 100% 1.080 0.540 Y TNNI1 n/a
20 TRCN0000098328 CACCGTGTATAAGATTGGAAA pLKO.1 1682 CDS 100% 4.950 6.930 N Gnl3l n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6058 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03435 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03435 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475838 GGCCAGAGGAAAACTCTTAGTACT pLX_317 17.4% 100% 100% V5 n/a
Download CSV