Transcript: Mouse NM_001190264.1

Mus musculus mitochondrial ribosomal protein S36 (Mrps36), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mrps36 (66128)
Length:
710
CDS:
92..394

Additional Resources:

NCBI RefSeq record:
NM_001190264.1
NBCI Gene record:
Mrps36 (66128)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375153 ACCAGACACTGCAGAAATTAT pLKO_005 292 CDS 100% 15.000 10.500 N Mrps36 n/a
2 TRCN0000200744 GCAATTTCACAGCATTCTAAA pLKO.1 233 CDS 100% 13.200 9.240 N Mrps36 n/a
3 TRCN0000200569 CAGAAGGGTTAGCTTTACAAT pLKO.1 422 3UTR 100% 5.625 3.938 N Mrps36 n/a
4 TRCN0000190856 CCAGACAGAAGGGTTAGCTTT pLKO.1 417 3UTR 100% 4.950 3.465 N Mrps36 n/a
5 TRCN0000328900 CCAGACAGAAGGGTTAGCTTT pLKO_005 417 3UTR 100% 4.950 3.465 N Mrps36 n/a
6 TRCN0000375228 ACAGAAGGAAACCTATGTCTC pLKO_005 333 CDS 100% 4.050 2.835 N Mrps36 n/a
7 TRCN0000328972 GTGAAGCCACACGCTCCATTA pLKO_005 134 CDS 100% 10.800 6.480 N Mrps36 n/a
8 TRCN0000191370 CACAGCATTCTAAAGGAAGTA pLKO.1 240 CDS 100% 4.950 2.475 Y Mrps36 n/a
9 TRCN0000191675 GAAATGGAATTTATCCAGCGT pLKO.1 359 CDS 100% 0.660 0.330 Y Mrps36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04573 pDONR223 100% 83.4% 83.4% None (many diffs) n/a
2 ccsbBroad304_04573 pLX_304 0% 83.4% 83.4% V5 (many diffs) n/a
3 TRCN0000465904 AGTACCGCGTCTGTCCTGGATTCA pLX_317 100% 83.4% 83.4% V5 (many diffs) n/a
Download CSV