Transcript: Mouse NM_001190414.1

Mus musculus glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase (Gne), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gne (50798)
Length:
2818
CDS:
355..2523

Additional Resources:

NCBI RefSeq record:
NM_001190414.1
NBCI Gene record:
Gne (50798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190414.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274686 GATGCCCTGATCTCGTTTAAC pLKO_005 1066 CDS 100% 13.200 10.560 N Gne n/a
2 TRCN0000024551 CCCTAGTTCTGTTTCCAAATA pLKO.1 1094 CDS 100% 13.200 9.240 N Gne n/a
3 TRCN0000274745 CCCTAGTTCTGTTTCCAAATA pLKO_005 1094 CDS 100% 13.200 9.240 N Gne n/a
4 TRCN0000274754 GCCAAGAACAAAGACTATATG pLKO_005 928 CDS 100% 13.200 9.240 N Gne n/a
5 TRCN0000323424 GTTTCTGCGAAGGCAAATTTG pLKO_005 2595 3UTR 100% 13.200 9.240 N Gne n/a
6 TRCN0000024553 CCTATGAAGAAAGGATTAGTT pLKO.1 1676 CDS 100% 5.625 3.938 N Gne n/a
7 TRCN0000274687 CCTATGAAGAAAGGATTAGTT pLKO_005 1676 CDS 100% 5.625 3.938 N Gne n/a
8 TRCN0000024550 CGGGACCATTGATGACTCTAT pLKO.1 771 CDS 100% 4.950 3.465 N Gne n/a
9 TRCN0000024549 GCTGCATTCAACCAAGCTGAT pLKO.1 1809 CDS 100% 4.050 2.835 N Gne n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190414.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02293 pDONR223 100% 87.6% 98.7% None (many diffs) n/a
2 ccsbBroad304_02293 pLX_304 0% 87.6% 98.7% V5 (many diffs) n/a
3 TRCN0000478834 GGGAACACCACAAGTGTTGCTTTT pLX_317 18.4% 87.6% 98.7% V5 (many diffs) n/a
4 ccsbBroadEn_14951 pDONR223 73.7% 87.1% 33.5% None (many diffs) n/a
5 ccsbBroad304_14951 pLX_304 0% 87.1% 33.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000474395 GCCAGAGTCTAAGCCCTCGGCCAA pLX_317 17.9% 87.1% 33.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV