Transcript: Mouse NM_001190870.1

Mus musculus potassium voltage-gated channel, Isk-related subfamily, gene 3 (Kcne3), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kcne3 (57442)
Length:
1333
CDS:
642..953

Additional Resources:

NCBI RefSeq record:
NM_001190870.1
NBCI Gene record:
Kcne3 (57442)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068589 GCAGTCTCATCCTGGGATATA pLKO.1 859 CDS 100% 13.200 9.240 N Kcne3 n/a
2 TRCN0000068592 CACAACCCTTCACAGTCACTT pLKO.1 707 CDS 100% 4.950 3.465 N Kcne3 n/a
3 TRCN0000068591 CATCAAGAACCGTGTGTCTAT pLKO.1 926 CDS 100% 4.950 3.465 N Kcne3 n/a
4 TRCN0000068590 CGTTCACGCAAAGTGGACAAA pLKO.1 882 CDS 100% 4.950 3.465 N Kcne3 n/a
5 TRCN0000068588 CCAGACAATCAAACTGAGGAT pLKO.1 756 CDS 100% 2.640 1.848 N Kcne3 n/a
6 TRCN0000045060 GAACCGTGTGTCTATGATCTA pLKO.1 932 CDS 100% 4.950 6.930 N KCNE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02288 pDONR223 100% 86.7% 93.2% None (many diffs) n/a
2 ccsbBroad304_02288 pLX_304 0% 86.7% 93.2% V5 (many diffs) n/a
3 TRCN0000473873 GTTAACAATACAGTTGTCTAATCA pLX_317 100% 86.7% 93.2% V5 (many diffs) n/a
Download CSV