Transcript: Human NM_001190918.2

Homo sapiens thyroid hormone receptor alpha (THRA), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
THRA (7067)
Length:
2266
CDS:
426..1781

Additional Resources:

NCBI RefSeq record:
NM_001190918.2
NBCI Gene record:
THRA (7067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020310 GTCAGGGTATATCCCTAGTTA pLKO.1 542 CDS 100% 5.625 7.875 N THRA n/a
2 TRCN0000343784 GTCAGGGTATATCCCTAGTTA pLKO_005 542 CDS 100% 5.625 7.875 N THRA n/a
3 TRCN0000020311 CAGCGAGTTTACCAAGATCAT pLKO.1 1070 CDS 100% 4.950 3.465 N THRA n/a
4 TRCN0000343721 CAGCGAGTTTACCAAGATCAT pLKO_005 1070 CDS 100% 4.950 3.465 N THRA n/a
5 TRCN0000222365 GCCATGGACTTGGTTCTAGAT pLKO.1 786 CDS 100% 4.950 3.465 N Thra n/a
6 TRCN0000020312 CAAACACAACATTCCGCACTT pLKO.1 1493 CDS 100% 4.050 2.835 N THRA n/a
7 TRCN0000020309 GCGTAAGCTGATTGAGCAGAA pLKO.1 827 CDS 100% 4.050 2.835 N THRA n/a
8 TRCN0000343720 GCGTAAGCTGATTGAGCAGAA pLKO_005 827 CDS 100% 4.050 2.835 N THRA n/a
9 TRCN0000020313 GTCACCAGATGGAAAGCGAAA pLKO.1 485 CDS 100% 4.050 2.835 N THRA n/a
10 TRCN0000343783 GTCACCAGATGGAAAGCGAAA pLKO_005 485 CDS 100% 4.050 2.835 N THRA n/a
11 TRCN0000027080 TGCCGCTTCAAGAAGTGCATT pLKO.1 753 CDS 100% 4.950 3.465 N Thra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492328 ACTGGCGTTCCAAATGCTACTAGA pLX_317 29.1% 92% 92% V5 (not translated due to prior stop codon) 1108_1109ins117 n/a
2 ccsbBroadEn_07066 pDONR223 100% 91.9% 91.8% None 1108_1109ins117;1353_1354insC n/a
3 ccsbBroad304_07066 pLX_304 0% 91.9% 91.8% V5 (not translated due to frame shift) 1108_1109ins117;1353_1354insC n/a
4 TRCN0000478935 CAGCACGGCCAGTTGTCAAACAGA pLX_317 27.2% 91.9% 91.8% V5 (not translated due to prior stop codon) 1108_1109ins117;1353_1354insC n/a
5 TRCN0000489623 TGTTACCACGGAGGCGAGAACGCA pLX_317 21.1% 91.9% 91.8% V5 1108_1109ins117;1353_1354insG n/a
Download CSV