Transcript: Human NM_001191.4

Homo sapiens BCL2 like 1 (BCL2L1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
BCL2L1 (598)
Length:
2385
CDS:
382..894

Additional Resources:

NCBI RefSeq record:
NM_001191.4
NBCI Gene record:
BCL2L1 (598)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001191.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033503 CGACGAGTTTGAACTGCGGTA pLKO.1 663 CDS 100% 2.160 3.024 N BCL2L1 n/a
2 TRCN0000331135 CGACGAGTTTGAACTGCGGTA pLKO_005 663 CDS 100% 2.160 3.024 N BCL2L1 n/a
3 TRCN0000033499 GCTCACTCTTCAGTCGGAAAT pLKO.1 872 CDS 100% 10.800 7.560 N BCL2L1 n/a
4 TRCN0000299585 GCTCACTCTTCAGTCGGAAAT pLKO_005 872 CDS 100% 10.800 7.560 N BCL2L1 n/a
5 TRCN0000033502 AGAGCTTTGAACAGGATACTT pLKO.1 743 CDS 100% 5.625 3.938 N BCL2L1 n/a
6 TRCN0000299587 AGAGCTTTGAACAGGATACTT pLKO_005 743 CDS 100% 5.625 3.938 N BCL2L1 n/a
7 TRCN0000033500 GTGGAACTCTATGGGAACAAT pLKO.1 766 CDS 100% 5.625 3.938 N BCL2L1 n/a
8 TRCN0000299588 GTGGAACTCTATGGGAACAAT pLKO_005 766 CDS 100% 5.625 3.938 N BCL2L1 n/a
9 TRCN0000004685 AGCTGGAGTCAGTTTAGTGAT pLKO.1 448 CDS 100% 4.950 3.465 N Bcl2l1 n/a
10 TRCN0000278077 AGCTGGAGTCAGTTTAGTGAT pLKO_005 448 CDS 100% 4.950 3.465 N Bcl2l1 n/a
11 TRCN0000033501 GTTTAGTGATGTGGAAGAGAA pLKO.1 459 CDS 100% 4.950 3.465 N BCL2L1 n/a
12 TRCN0000299586 GTTTAGTGATGTGGAAGAGAA pLKO_005 459 CDS 100% 4.950 3.465 N BCL2L1 n/a
13 TRCN0000004682 CAGGAGAACCACTACATGCAA pLKO.1 973 3UTR 100% 3.000 2.100 N Bcl2l1 n/a
14 TRCN0000278076 CAGGAGAACCACTACATGCAA pLKO_005 973 3UTR 100% 3.000 2.100 N Bcl2l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001191.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00156 pDONR223 100% 72.9% 72.9% None 374_375ins189 n/a
2 ccsbBroad304_00156 pLX_304 87.4% 72.9% 72.9% V5 374_375ins189 n/a
3 TRCN0000472603 CGCGCAGAGAGTGGTAGCATGAGA pLX_317 74.2% 72.9% 72.9% V5 374_375ins189 n/a
4 TRCN0000489920 TATGCTACCACAGAGAAAGCAATC pLX_317 70% 72.9% 72.9% V5 (not translated due to prior stop codon) 374_375ins189 n/a
Download CSV