Transcript: Human NM_001195037.2

Homo sapiens epithelial cell transforming 2 like (ECT2L), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
ECT2L (345930)
Length:
4343
CDS:
186..2900

Additional Resources:

NCBI RefSeq record:
NM_001195037.2
NBCI Gene record:
ECT2L (345930)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268689 ACTACGTAAGAAGGAGTTATT pLKO_005 770 CDS 100% 13.200 18.480 N ECT2L n/a
2 TRCN0000268693 CTGTACCCATCCCGAAGATTT pLKO_005 2304 CDS 100% 13.200 18.480 N ECT2L n/a
3 TRCN0000268646 ACGCTTCATTTCTCTATATAT pLKO_005 431 CDS 100% 15.000 10.500 N ECT2L n/a
4 TRCN0000268647 GGCACAGAGCATCGGAATATT pLKO_005 1196 CDS 100% 15.000 10.500 N ECT2L n/a
5 TRCN0000268688 TACTCCTCTAGAGAGCATTAA pLKO_005 3717 3UTR 100% 13.200 9.240 N ECT2L n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3369 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3370 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05500 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05500 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476145 AGCCGGTTCGCAAAATTCCTTCCC pLX_317 14.5% 100% 100% V5 n/a
Download CSV