Transcript: Human NM_001197239.2

Homo sapiens butyrophilin subfamily 2 member A2 (BTN2A2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
BTN2A2 (10385)
Length:
2953
CDS:
105..1046

Additional Resources:

NCBI RefSeq record:
NM_001197239.2
NBCI Gene record:
BTN2A2 (10385)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001197239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414314 ATAACCACATTAAGCCCAATA pLKO_005 1361 3UTR 100% 10.800 15.120 N BTN2A2 n/a
2 TRCN0000158981 GAAATTGCACAGCAACTTCAA pLKO.1 396 CDS 100% 4.950 3.960 N BTN2A2 n/a
3 TRCN0000415258 GACTCACAGCCATGCAGATAA pLKO_005 1060 3UTR 100% 13.200 9.240 N BTN2A2 n/a
4 TRCN0000159656 GCAATCTATTGTGTCCAAATA pLKO.1 2033 3UTR 100% 13.200 9.240 N BTN2A2 n/a
5 TRCN0000160867 GCGATTTCTTAGCCTCCATAA pLKO.1 2777 3UTR 100% 10.800 7.560 N BTN2A2 n/a
6 TRCN0000158753 GCTTCAAACTTCCTGATCTAA pLKO.1 1834 3UTR 100% 5.625 3.938 N BTN2A2 n/a
7 TRCN0000159657 GTTGCATCAAGAAACTTCAAA pLKO.1 325 CDS 100% 5.625 3.938 N BTN2A2 n/a
8 TRCN0000164364 CTTCAGGTTAGGGTCTGATGA pLKO.1 923 CDS 100% 4.950 3.465 N BTN2A2 n/a
9 TRCN0000163113 GACCCTGGAGATGTTTGGAAA pLKO.1 728 CDS 100% 4.950 3.465 N BTN2A2 n/a
10 TRCN0000146422 CCTGGGATGAAGATGAATGAA pLKO.1 1651 3UTR 100% 5.625 2.813 Y BTN2A1 n/a
11 TRCN0000164626 CTGGACTATGAAGCTGGAGAT pLKO.1 822 CDS 100% 4.050 2.025 Y BTN2A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001197239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471498 CGGTGAGGTTTGCTCAGGCCGTCA pLX_317 29.3% 59.8% 59.8% V5 91_92ins630 n/a
2 ccsbBroadEn_10454 pDONR223 100% 59.7% 59.6% None 91_92ins630;937C>A n/a
3 ccsbBroad304_10454 pLX_304 0% 59.7% 59.6% V5 91_92ins630;937C>A n/a
4 ccsbBroadEn_15709 pDONR223 0% 23.1% 22.8% None (many diffs) n/a
5 ccsbBroad304_15709 pLX_304 0% 23.1% 22.8% V5 (many diffs) n/a
6 TRCN0000470536 CTCCCTTGAATAGCACGCCTCGCG pLX_317 42.9% 23% 22.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV