Transcript: Human NM_001198645.2

Homo sapiens tripartite motif containing 6 (TRIM6), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TRIM6 (117854)
Length:
2836
CDS:
285..1226

Additional Resources:

NCBI RefSeq record:
NM_001198645.2
NBCI Gene record:
TRIM6 (117854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034079 CCACTACTCTTTGTCCATATT pLKO.1 1153 CDS 100% 13.200 18.480 N TRIM6 n/a
2 TRCN0000300374 CCACTACTCTTTGTCCATATT pLKO_005 1153 CDS 100% 13.200 18.480 N TRIM6 n/a
3 TRCN0000304061 GAATCCACACACAGCTAATTT pLKO_005 674 CDS 100% 15.000 10.500 N TRIM6 n/a
4 TRCN0000034082 CCCATCTACACTTTCTCTAAA pLKO.1 1122 CDS 100% 13.200 9.240 N TRIM6 n/a
5 TRCN0000034080 GTGAGGTTTGTGGGAGCTAAA pLKO.1 726 CDS 100% 10.800 7.560 N TRIM6 n/a
6 TRCN0000300453 GTGAGGTTTGTGGGAGCTAAA pLKO_005 726 CDS 100% 10.800 7.560 N TRIM6 n/a
7 TRCN0000304060 TGGTGAGAGTAAGCATCTTTG pLKO_005 1682 3UTR 100% 10.800 7.560 N TRIM6 n/a
8 TRCN0000152377 GAGTTTAATCAGCTGCGAAAT pLKO.1 315 CDS 100% 10.800 5.400 Y TRIM6-TRIM34 n/a
9 TRCN0000154016 CCCTACAAAGCTGAGAAGTAT pLKO.1 569 CDS 100% 5.625 2.813 Y TRIM6-TRIM34 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1594 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1594 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05690 pDONR223 100% 32.3% 27.2% None (many diffs) n/a
2 ccsbBroad304_05690 pLX_304 0% 32.3% 27.2% V5 (many diffs) n/a
3 TRCN0000477088 ATACACCGAAGCTAGGTACGCAAA pLX_317 15% 32.3% 27.2% V5 (many diffs) n/a
Download CSV