Transcript: Mouse NM_001198911.1

Mus musculus rho/rac guanine nucleotide exchange factor (GEF) 2 (Arhgef2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Arhgef2 (16800)
Length:
4422
CDS:
327..3233

Additional Resources:

NCBI RefSeq record:
NM_001198911.1
NBCI Gene record:
Arhgef2 (16800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001198911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432135 TGTCCGTGGAATCCCTTATTG pLKO_005 829 CDS 100% 13.200 18.480 N Arhgef2 n/a
2 TRCN0000419564 AGCTAAAGATGCCCGCTATAC pLKO_005 371 CDS 100% 10.800 15.120 N Arhgef2 n/a
3 TRCN0000109987 CGACGCTTTATACTTGAGCTT pLKO.1 2942 CDS 100% 2.640 3.696 N Arhgef2 n/a
4 TRCN0000427597 ACAGCCATTGATCAATCTTTA pLKO_005 2489 CDS 100% 13.200 9.240 N Arhgef2 n/a
5 TRCN0000109988 CCCTCATTTGTCCTACATGTA pLKO.1 475 CDS 100% 4.950 3.465 N Arhgef2 n/a
6 TRCN0000109985 GCAGGAGATTTACAACCGAAT pLKO.1 1604 CDS 100% 4.050 2.835 N Arhgef2 n/a
7 TRCN0000109989 TCAGTGACATTCACACACGTT pLKO.1 1135 CDS 100% 2.640 1.848 N Arhgef2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11345 pDONR223 100% 83.4% 87.2% None (many diffs) n/a
2 ccsbBroad304_11345 pLX_304 0% 83.4% 87.2% V5 (many diffs) n/a
3 TRCN0000468482 GATTAACGCATCTTACAAGATGTC pLX_317 13.8% 83.4% 87.2% V5 (many diffs) n/a
Download CSV