Transcript: Mouse NM_001198969.2

Mus musculus intersectin 2 (Itsn2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Itsn2 (20403)
Length:
2350
CDS:
258..2216

Additional Resources:

NCBI RefSeq record:
NM_001198969.2
NBCI Gene record:
Itsn2 (20403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001198969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382401 CAAACTCAGCTAGCTACTATT pLKO_005 1095 CDS 100% 13.200 18.480 N Itsn2 n/a
2 TRCN0000381459 GGCCCAGTCTCTGATTGATTT pLKO_005 881 CDS 100% 13.200 18.480 N Itsn2 n/a
3 TRCN0000111753 CCCTATGTTCTCTCCACTAAT pLKO.1 575 CDS 100% 13.200 10.560 N Itsn2 n/a
4 TRCN0000375264 TCCCTGAGAAGCAGCTATTAA pLKO_005 1924 CDS 100% 15.000 10.500 N Itsn2 n/a
5 TRCN0000328998 GCCAAATATGTGGGCTATTAC pLKO_005 293 CDS 100% 13.200 9.240 N Itsn2 n/a
6 TRCN0000111754 CCTGGAAATTATGGAAATCAA pLKO.1 1853 CDS 100% 5.625 3.938 N Itsn2 n/a
7 TRCN0000111752 GCAGACTACAAGATGTCCAAA pLKO.1 1780 CDS 100% 4.950 3.465 N Itsn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10457 pDONR223 100% 34.1% 35% None (many diffs) n/a
2 ccsbBroad304_10457 pLX_304 0% 34.1% 35% V5 (many diffs) n/a
3 TRCN0000481239 TCCCATTTCGAGTAAGGGAGCATT pLX_317 7.4% 34.1% 35% V5 (many diffs) n/a
Download CSV