Transcript: Human NM_001198986.2

Homo sapiens EPPIN-WFDC6 readthrough (EPPIN-WFDC6), mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
EPPIN-WFDC6 (100526773)
Length:
1837
CDS:
45..584

Additional Resources:

NCBI RefSeq record:
NM_001198986.2
NBCI Gene record:
EPPIN-WFDC6 (100526773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373644 CTGGTCTGACTGATTGGTTAT pLKO_005 109 CDS 100% 10.800 5.400 Y EPPIN n/a
2 TRCN0000073717 CAGCCGTGGAAAGAAATGTTT pLKO.1 533 CDS 100% 5.625 2.813 Y WFDC6 n/a
3 TRCN0000073716 TGGAATGCGAAGTGGAAGAAA pLKO.1 457 CDS 100% 5.625 2.813 Y WFDC6 n/a
4 TRCN0000073590 TGGTGGTATGACAAGAAAGAT pLKO.1 321 CDS 100% 5.625 2.813 Y EPPIN n/a
5 TRCN0000073589 CCAGGGAAACAATAACAACTT pLKO.1 374 CDS 100% 4.950 2.475 Y EPPIN n/a
6 TRCN0000073715 GAAATAGACCAGTGTACCAAA pLKO.1 474 CDS 100% 4.950 2.475 Y WFDC6 n/a
7 TRCN0000073591 TCAAACAAGATGTATGCGAAA pLKO.1 259 CDS 100% 4.050 2.025 Y EPPIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03786 pDONR223 100% 74.1% 72.7% None (many diffs) n/a
2 ccsbBroad304_03786 pLX_304 0% 74.1% 72.7% V5 (many diffs) n/a
3 TRCN0000481292 TATTGACGGGACACTCAACAGTAC pLX_317 100% 74.1% 72.7% V5 (many diffs) n/a
4 ccsbBroadEn_04954 pDONR223 100% 31% 32.7% None (many diffs) n/a
5 ccsbBroad304_04954 pLX_304 0% 31% 32.7% V5 (many diffs) n/a
6 TRCN0000477875 ACCATGGGCGGGACACCCTTGCAC pLX_317 80.4% 31% 32.7% V5 (many diffs) n/a
Download CSV