Transcript: Human NM_001199055.2

Homo sapiens cell death inducing p53 target 1 (CDIP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CDIP1 (29965)
Length:
2589
CDS:
177..686

Additional Resources:

NCBI RefSeq record:
NM_001199055.2
NBCI Gene record:
CDIP1 (29965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108059 CCACCACACATGAGTGCAGAT pLKO.1 378 CDS 100% 4.050 3.240 N CDIP1 n/a
2 TRCN0000414553 AGGTTCAGTCCAGACTCTTTC pLKO_005 1015 3UTR 100% 10.800 7.560 N CDIP1 n/a
3 TRCN0000444288 TGCTGCAGGGAGAGATCTTTG pLKO_005 439 CDS 100% 10.800 7.560 N CDIP1 n/a
4 TRCN0000430722 AGCCTACATCTACACGTACAA pLKO_005 653 CDS 100% 4.950 3.465 N CDIP1 n/a
5 TRCN0000438153 CACGTAGGACAGGGTCACAAA pLKO_005 1152 3UTR 100% 4.950 3.465 N CDIP1 n/a
6 TRCN0000108058 CTACGAGATTGGCTTGATGAA pLKO.1 521 CDS 100% 4.950 3.465 N CDIP1 n/a
7 TRCN0000413429 TGTTGCTTCATGGGATGTGAT pLKO_005 561 CDS 100% 4.950 3.465 N CDIP1 n/a
8 TRCN0000108055 GCCCTGTCTTTATTTCCTGAA pLKO.1 1765 3UTR 100% 4.050 2.835 N CDIP1 n/a
9 TRCN0000238043 AGGCCATCACCACCAAGATCT pLKO_005 499 CDS 100% 4.950 2.970 N Cdip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03119 pDONR223 100% 81.2% 81.2% None 240_241ins117 n/a
2 ccsbBroad304_03119 pLX_304 0% 81.2% 81.2% V5 240_241ins117 n/a
3 TRCN0000471976 GTCTTGGCCGAGATCGTTTGCTGC pLX_317 61.9% 81.2% 81.2% V5 (not translated due to prior stop codon) 240_241ins117 n/a
Download CSV