Transcript: Human NM_001199290.3

Homo sapiens PHOSPHO2-KLHL23 readthrough (PHOSPHO2-KLHL23), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PHOSPHO2-KLHL23 (100526832)
Length:
4183
CDS:
361..2037

Additional Resources:

NCBI RefSeq record:
NM_001199290.3
NBCI Gene record:
PHOSPHO2-KLHL23 (100526832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199290.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413788 AGCTGCTTGCAGCAATTATTT pLKO_005 525 CDS 100% 15.000 7.500 Y KLHL23 n/a
2 TRCN0000436278 ATAAGATCCGCTCCCTAATAT pLKO_005 1109 CDS 100% 15.000 7.500 Y KLHL23 n/a
3 TRCN0000431644 CCTATTGCAAACATGATTAAA pLKO_005 1552 CDS 100% 15.000 7.500 Y KLHL23 n/a
4 TRCN0000355710 CTATCATAGAGCCAGTTATTA pLKO_005 956 CDS 100% 15.000 7.500 Y KLHL23 n/a
5 TRCN0000216571 GAGCAGAAATACCAGATTATA pLKO.1 1265 CDS 100% 15.000 7.500 Y Klhl23 n/a
6 TRCN0000415755 ATGCTCAATGCCAGGTATTAC pLKO_005 1423 CDS 100% 13.200 6.600 Y KLHL23 n/a
7 TRCN0000355682 TGGTAAGGCACTTGGATATTG pLKO_005 749 CDS 100% 13.200 6.600 Y KLHL23 n/a
8 TRCN0000006954 GCTGAGTTCTATGATCCTTTA pLKO.1 1516 CDS 100% 10.800 5.400 Y KLHL23 n/a
9 TRCN0000006955 CCTGTGTCTTACATGATGTTA pLKO.1 1592 CDS 100% 5.625 2.813 Y KLHL23 n/a
10 TRCN0000006953 CTACCTTTGTAGTGAATCTTT pLKO.1 2548 3UTR 100% 5.625 2.813 Y KLHL23 n/a
11 TRCN0000006956 CCTTTGACAAATGTTTGGATT pLKO.1 1240 CDS 100% 4.950 2.475 Y KLHL23 n/a
12 TRCN0000193370 CCAGATCTTAATAAGTGGGAA pLKO.1 1954 CDS 100% 2.640 1.320 Y Klhl23 n/a
13 TRCN0000006957 CCTCTATAATCTACTGAGCTA pLKO.1 1014 CDS 100% 2.640 1.320 Y KLHL23 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2693 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199290.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09679 pDONR223 100% 99.9% 100% None 1416C>T n/a
2 ccsbBroad304_09679 pLX_304 0% 99.9% 100% V5 1416C>T n/a
3 TRCN0000466460 CAATTACAGAATAACGTAGCTAAC pLX_317 20% 99.9% 100% V5 1416C>T n/a
Download CSV