Transcript: Human NM_001199291.3

Homo sapiens hydroxysteroid 17-beta dehydrogenase 4 (HSD17B4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
HSD17B4 (3295)
Length:
2881
CDS:
258..2543

Additional Resources:

NCBI RefSeq record:
NM_001199291.3
NBCI Gene record:
HSD17B4 (3295)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220386 CGGAGTTATCATAGGTCAGAA pLKO.1 1463 CDS 100% 4.950 6.930 N HSD17B4 n/a
2 TRCN0000220383 CCTCTCTTAATCAGGCTGCTT pLKO.1 1822 CDS 100% 2.640 2.112 N HSD17B4 n/a
3 TRCN0000246134 AGAAGTATGGAAGGATTATTA pLKO_005 754 CDS 100% 15.000 10.500 N HSD17B4 n/a
4 TRCN0000246135 AGAATCAACTGGCAGTATAAT pLKO_005 1199 CDS 100% 15.000 10.500 N HSD17B4 n/a
5 TRCN0000246136 AGGGCACACTACACTATTAAT pLKO_005 2544 CDS 100% 15.000 10.500 N HSD17B4 n/a
6 TRCN0000246132 TACGGAACTGGAAGCTATTAT pLKO_005 1349 CDS 100% 15.000 10.500 N HSD17B4 n/a
7 TRCN0000246133 TGATGAAGACTGGGATATAAT pLKO_005 668 CDS 100% 15.000 10.500 N HSD17B4 n/a
8 TRCN0000220385 GCTGTATTTGAGTGGCATATA pLKO.1 2274 CDS 100% 13.200 9.240 N HSD17B4 n/a
9 TRCN0000220384 GCTGCTGATAAGGTTGTTGAA pLKO.1 492 CDS 100% 4.950 3.465 N HSD17B4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00793 pDONR223 100% 95.2% 91.4% None (many diffs) n/a
2 ccsbBroad304_00793 pLX_304 0% 95.2% 91.4% V5 (many diffs) n/a
3 TRCN0000467393 CTCCCACTTTAGCCATCCTACATA pLX_317 19.7% 95.2% 91.4% V5 (many diffs) n/a
Download CSV