Transcript: Human NM_001199377.2

Homo sapiens acyl-CoA synthetase bubblegum family member 1 (ACSBG1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
ACSBG1 (23205)
Length:
6203
CDS:
65..2227

Additional Resources:

NCBI RefSeq record:
NM_001199377.2
NBCI Gene record:
ACSBG1 (23205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199377.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153405 GCCGACCCTATTATTCCATTA pLKO.1 2690 3UTR 100% 10.800 15.120 N ACSBG1 n/a
2 TRCN0000112513 GCGCCTCAAAGAATTAATCAT pLKO.1 1744 CDS 100% 5.625 7.875 N Acsbg1 n/a
3 TRCN0000150785 GCGCCTCAAAGAATTAATCAT pLKO.1 1744 CDS 100% 5.625 7.875 N ACSBG1 n/a
4 TRCN0000157553 GCTGTGTGCTAGTCTACACTT pLKO.1 879 CDS 100% 4.950 3.960 N ACSBG1 n/a
5 TRCN0000157552 GCCAGTACATCGCTTATGACT pLKO.1 639 CDS 100% 3.000 2.400 N ACSBG1 n/a
6 TRCN0000157292 CCAGAACGAAAGGGCTGATAA pLKO.1 2490 3UTR 100% 13.200 9.240 N ACSBG1 n/a
7 TRCN0000153496 CGCCAACAATAGCTGACAATT pLKO.1 2386 3UTR 100% 13.200 9.240 N ACSBG1 n/a
8 TRCN0000153204 CCTGACTTACTCTGGAATCTT pLKO.1 2659 3UTR 100% 5.625 3.938 N ACSBG1 n/a
9 TRCN0000157807 CATGTCCAGTCCCTACAACTA pLKO.1 1504 CDS 100% 4.950 3.465 N ACSBG1 n/a
10 TRCN0000154174 CATATTCATGGGCTACCTGAA pLKO.1 1624 CDS 100% 4.050 2.835 N ACSBG1 n/a
11 TRCN0000150517 GAGATCATAGAGAAGAAGGAT pLKO.1 1994 CDS 100% 3.000 2.100 N ACSBG1 n/a
12 TRCN0000156616 GAACACATCTCCTACTCCCAA pLKO.1 455 CDS 100% 2.640 1.848 N ACSBG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199377.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489202 CGCCCACATCTTCGGCGATACCAG pLX_317 14.5% 99.4% 99.3% V5 446_447insCCTGAAGCTCGG;2160_2161insG n/a
2 ccsbBroadEn_07854 pDONR223 100% 99.2% 99.3% None (many diffs) n/a
3 ccsbBroad304_07854 pLX_304 0% 99.2% 99.3% V5 (many diffs) n/a
4 TRCN0000481289 GGCCCAGGGAAACAACGAGGCACC pLX_317 22.2% 99.2% 99.3% V5 (many diffs) n/a
5 TRCN0000489458 GCCGTTAGCATGGAGTTATCGAAG pLX_317 19.3% 99% 99.4% V5 (not translated due to prior stop codon) 446_447insCCTGAAGCTCGG;1462C>A;2160_2161insTAAAAGCT n/a
Download CSV