Transcript: Human NM_001199835.1

Homo sapiens sorting nexin 10 (SNX10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SNX10 (29887)
Length:
2638
CDS:
263..868

Additional Resources:

NCBI RefSeq record:
NM_001199835.1
NBCI Gene record:
SNX10 (29887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137686 GCTTGGACACAGTAGTGATGA pLKO.1 799 CDS 100% 4.950 6.930 N SNX10 n/a
2 TRCN0000138433 CCAAAGTAATGCGTTGCTGGT pLKO.1 454 CDS 100% 2.160 1.728 N SNX10 n/a
3 TRCN0000379482 TGTCATGATGTTAGGTATTTA pLKO_005 964 3UTR 100% 15.000 10.500 N SNX10 n/a
4 TRCN0000134817 CCTGTGTACGAAGAAGATATA pLKO.1 405 CDS 100% 13.200 9.240 N SNX10 n/a
5 TRCN0000135959 GCTTTGTTACCCAGCCTAATT pLKO.1 2057 3UTR 100% 13.200 9.240 N SNX10 n/a
6 TRCN0000379858 TAGGTAACTAAGTAGCATTTA pLKO_005 1187 3UTR 100% 13.200 9.240 N SNX10 n/a
7 TRCN0000135836 CATCCTGTGTACGAAGAAGAT pLKO.1 402 CDS 100% 4.950 3.465 N SNX10 n/a
8 TRCN0000134132 CTGGCATTCTTACATTGACTA pLKO.1 337 CDS 100% 4.950 3.465 N SNX10 n/a
9 TRCN0000135595 GTCTGGAAGATTTCCTCAGAA pLKO.1 552 CDS 100% 4.950 3.465 N SNX10 n/a
10 TRCN0000134926 CCAAGTTTCATCCATGTTGAA pLKO.1 1973 3UTR 100% 4.950 2.970 N SNX10 n/a
11 TRCN0000134391 GCAATTCACAAGTTTGCCTTA pLKO.1 695 CDS 100% 4.050 2.430 N SNX10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08131 pDONR223 100% 99.6% 99.5% None 9G>A;340G>N n/a
2 ccsbBroad304_08131 pLX_304 0% 99.6% 99.5% V5 9G>A;340G>N n/a
3 TRCN0000471561 TATCCAGAATTGACTTTCCCCTGC pLX_317 75.9% 99.6% 99.5% V5 9G>A;340G>T n/a
Download CSV