Transcript: Human NM_001199864.2

Homo sapiens BCL2L2-PABPN1 readthrough (BCL2L2-PABPN1), mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
BCL2L2-PABPN1 (100529063)
Length:
2059
CDS:
159..1160

Additional Resources:

NCBI RefSeq record:
NM_001199864.2
NBCI Gene record:
BCL2L2-PABPN1 (100529063)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281945 ACCATACTGTGTGACAAATTT pLKO_005 843 CDS 100% 15.000 7.500 Y PABPN1 n/a
2 TRCN0000272500 CCCAAAGGGTTTGCGTATATA pLKO_005 873 CDS 100% 15.000 7.500 Y PABPN1 n/a
3 TRCN0000272447 CCTTAGATGAGTCCCTATTTA pLKO_005 931 CDS 100% 15.000 7.500 Y PABPN1 n/a
4 TRCN0000000124 AGGTAGAGAAGCAGATGAATA pLKO.1 664 CDS 100% 13.200 6.600 Y PABPN1 n/a
5 TRCN0000375066 GGTAGAGAAGCAGATGAATAT pLKO_005 665 CDS 100% 13.200 6.600 Y Pabpn1 n/a
6 TRCN0000033504 TGGCAGACTTTGTAGGTTATA pLKO.1 199 CDS 100% 13.200 6.600 Y BCL2L2 n/a
7 TRCN0000272502 CCAAACTGTTCTGCTTGTTAC pLKO_005 1541 3UTR 100% 10.800 5.400 Y PABPN1 n/a
8 TRCN0000272446 TAGAGCGACATCATGGTATTC pLKO_005 1130 CDS 100% 10.800 5.400 Y PABPN1 n/a
9 TRCN0000305879 TAGAGCGACATCATGGTATTC pLKO_005 1130 CDS 100% 10.800 5.400 Y Pabpn1 n/a
10 TRCN0000033508 CCCAGGTCTCCGATGAACTTT pLKO.1 397 CDS 100% 5.625 2.813 Y BCL2L2 n/a
11 TRCN0000000122 GAGGTAGAGAAGCAGATGAAT pLKO.1 663 CDS 100% 5.625 2.813 Y PABPN1 n/a
12 TRCN0000000121 CTCTCGATTCTACAGTGGTTT pLKO.1 1070 CDS 100% 4.950 2.475 Y PABPN1 n/a
13 TRCN0000102539 GTGGTTCAGTCAACCGTGTTA pLKO.1 823 CDS 100% 4.950 2.475 Y Pabpn1 n/a
14 TRCN0000324929 GTGGTTCAGTCAACCGTGTTA pLKO_005 823 CDS 100% 4.950 2.475 Y Pabpn1 n/a
15 TRCN0000033507 CAGAAGGGTTATGTCTGTGGA pLKO.1 228 CDS 100% 2.640 1.320 Y BCL2L2 n/a
16 TRCN0000000120 CCCATAACTAACTGCTGAGGA pLKO.1 1312 3UTR 100% 2.640 1.320 Y PABPN1 n/a
17 TRCN0000033505 GTCAACAAGGAGATGGAACCA pLKO.1 489 CDS 100% 2.640 1.320 Y BCL2L2 n/a
18 TRCN0000437498 AGCTGGAGATGAGTTCGAGAC pLKO_005 302 CDS 100% 2.250 1.125 Y BCL2L2 n/a
19 TRCN0000000123 CAGATGAATATGAGTCCACCT pLKO.1 675 CDS 100% 2.160 1.080 Y PABPN1 n/a
20 TRCN0000321106 GTGCTGAGAGTGTCAACAAAG pLKO_005 478 CDS 100% 10.800 5.400 Y Bcl2l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13989 pDONR223 100% 73.4% 50.3% None (many diffs) n/a
2 ccsbBroad304_13989 pLX_304 0% 73.4% 50.3% V5 (many diffs) n/a
3 TRCN0000478024 TTGCGATAGGTCACGCTAGTCCTC pLX_317 50.8% 73.4% 50.3% V5 (many diffs) n/a
4 ccsbBroadEn_05881 pDONR223 100% 52.5% 46.6% None (many diffs) n/a
5 ccsbBroad304_05881 pLX_304 0% 52.5% 46.6% V5 (many diffs) n/a
6 TRCN0000466971 TTAAGTTAGCCAGTTCCTGTGTAT pLX_317 49.5% 52.5% 46.6% V5 (many diffs) n/a
Download CSV