Transcript: Human NM_001199900.1

Homo sapiens pyruvate dehydrogenase kinase 2 (PDK2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
PDK2 (5164)
Length:
987
CDS:
162..761

Additional Resources:

NCBI RefSeq record:
NM_001199900.1
NBCI Gene record:
PDK2 (5164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195527 CCAACCAGAACATCCAGTACT pLKO.1 601 CDS 100% 4.950 3.465 N PDK2 n/a
2 TRCN0000002316 GTACATAGAGCACTTCAGCAA pLKO.1 215 CDS 100% 2.640 1.848 N PDK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01166 pDONR223 100% 46% 40.5% None (many diffs) n/a
2 ccsbBroad304_01166 pLX_304 0% 46% 40.5% V5 (many diffs) n/a
3 TRCN0000480761 CTTTTTCCCATACTAGCCCAATTG pLX_317 34.6% 46% 40.5% V5 (many diffs) n/a
4 ccsbBroadEn_14738 pDONR223 0% 46% 40.5% None (many diffs) n/a
5 ccsbBroad304_14738 pLX_304 0% 46% 40.5% V5 (many diffs) n/a
6 TRCN0000488642 TTTTAGCACGTTTTCCGACTGCTG pLX_317 28.4% 46% 40.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV