Transcript: Mouse NM_001201341.1

Mus musculus musashi RNA-binding protein 2 (Msi2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Msi2 (76626)
Length:
780
CDS:
178..654

Additional Resources:

NCBI RefSeq record:
NM_001201341.1
NBCI Gene record:
Msi2 (76626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001201341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062808 CCAGCAAGTGTAGATAAAGTA pLKO.1 391 CDS 100% 5.625 7.875 N MSI2 n/a
2 TRCN0000062812 AGATAGCCTTAGAGACTATTT pLKO.1 279 CDS 100% 13.200 9.240 N MSI2 n/a
3 TRCN0000071977 CCACCATGAGTTAGATTCCAA pLKO.1 423 CDS 100% 3.000 2.100 N Msi2 n/a
4 TRCN0000324687 CCACCATGAGTTAGATTCCAA pLKO_005 423 CDS 100% 3.000 2.100 N Msi2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09483 pDONR223 100% 43.2% 33.4% None (many diffs) n/a
2 ccsbBroad304_09483 pLX_304 0% 43.2% 33.4% V5 (many diffs) n/a
3 TRCN0000465338 GATCTCGCCGAGCCAAACTTGCCT pLX_317 29.5% 43.2% 33.4% V5 (many diffs) n/a
Download CSV