Construct: ORF TRCN0000465338
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015237.1_s317c1
- Derived from:
- ccsbBroadEn_09483
- DNA Barcode:
- GATCTCGCCGAGCCAAACTTGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MSI2 (124540)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465338
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 124540 | MSI2 | musashi RNA binding protein 2 | NM_138962.4 | 99.7% | 99.6% | 6G>N;321A>G |
| 2 | human | 124540 | MSI2 | musashi RNA binding protein 2 | XM_005257014.3 | 94.6% | 94.5% | 6G>N;321A>G;788_841del |
| 3 | human | 124540 | MSI2 | musashi RNA binding protein 2 | XM_005257015.3 | 91.1% | 89.7% | (many diffs) |
| 4 | human | 124540 | MSI2 | musashi RNA binding protein 2 | NM_001322250.1 | 88.3% | 88.4% | 0_1ins66;255A>G;722_775del |
| 5 | human | 124540 | MSI2 | musashi RNA binding protein 2 | XM_017024147.2 | 85.7% | 85.5% | 6G>N;308_309ins93;695_748del |
| 6 | human | 124540 | MSI2 | musashi RNA binding protein 2 | XM_017024148.1 | 82% | 81% | (many diffs) |
| 7 | human | 124540 | MSI2 | musashi RNA binding protein 2 | NM_001322251.2 | 73.7% | 74.3% | (many diffs) |
| 8 | human | 124540 | MSI2 | musashi RNA binding protein 2 | NM_170721.2 | 69% | 69.8% | (many diffs) |
| 9 | human | 124540 | MSI2 | musashi RNA binding protein 2 | XM_017024149.2 | 68.5% | 65.7% | (many diffs) |
| 10 | human | 124540 | MSI2 | musashi RNA binding protein 2 | XM_011524286.2 | 64.6% | 64.7% | 0_1ins312;9A>G;476_529del |
| 11 | human | 124540 | MSI2 | musashi RNA binding protein 2 | XM_011524287.3 | 59.4% | 53.7% | (many diffs) |
| 12 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_006534442.3 | 95.3% | 99.3% | (many diffs) |
| 13 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_017314830.1 | 93% | 96.7% | (many diffs) |
| 14 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | NM_054043.3 | 90.3% | 94.2% | (many diffs) |
| 15 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_006534440.2 | 88.8% | 92.6% | (many diffs) |
| 16 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_011249302.1 | 88.3% | 91.8% | (many diffs) |
| 17 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_006534439.2 | 86.8% | 90.2% | (many diffs) |
| 18 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_006534435.2 | 84.5% | 88.1% | (many diffs) |
| 19 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_006534438.2 | 83.7% | 85.7% | (many diffs) |
| 20 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_006534432.2 | 82.7% | 85.9% | (many diffs) |
| 21 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_006534434.2 | 81.5% | 83.7% | (many diffs) |
| 22 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_006534431.2 | 79.8% | 81.7% | (many diffs) |
| 23 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_006534441.3 | 75.3% | 72.8% | (many diffs) |
| 24 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_011249304.2 | 69.7% | 69.3% | (many diffs) |
| 25 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XM_011249305.2 | 63.5% | 61.9% | (many diffs) |
| 26 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | NM_001201341.1 | 43.2% | 33.4% | (many diffs) |
| 27 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XR_879764.1 | 14.2% | (many diffs) | |
| 28 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XR_388550.2 | 14.1% | (many diffs) | |
| 29 | mouse | 76626 | Msi2 | musashi RNA-binding protein 2 | XR_001780073.1 | 14% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1050
- ORF length:
- 984
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ngcaaatggg agccaaggca cctcgggcag cgccaacgac tcccagcacg 121 accccggtaa aatgtttatc ggtggactga gctggcagac ctcaccagat agccttagag 181 actattttag caaatttgga gaaattagag aatgtatggt catgagagat cccactacga 241 aacgctccag aggcttcggt ttcgtcacgt tcgcagaccc agcaagtgta gataaagtat 301 taggtcagcc ccaccatgag ttagattcca agacgattga ccccaaagtt gcatttcctc 361 gtcgagcgca acccaagatg gtcacgagaa caaagaaaat atttgtaggc gggttatctg 421 cgaacacagt agtggaagat gtaaagcaat atttcgagca gtttggcaag gtggaagatg 481 caatgctgat gtttgataaa actaccaaca ggcacagagg gtttggcttt gtcacttttg 541 agaatgaaga tgttgtggag aaagtctgtg agattcattt ccatgaaatc aataataaaa 601 tggtagaatg taagaaagct cagccgaaag aagtcatgtt cccacctggg acaagaggcc 661 gggcccgggg actgccttac accatggacg cgttcatgct tggcatgggg atgctgggat 721 atcccaactt cgtggcgacc tatggccgtg gctaccccgg attTGCTCCA AGCTATGGCT 781 ATCAGTTCCC AGGCTTCCCA GCAGCGGCTT ATGGACCAGT GGCAGCAGCG GCGGTGGCGG 841 CAGCAAGAGG ATCAGGCTCC AACCCGGCGC GGCCCGGAGG CTTCCCGGGG GCCAACAGCC 901 CAGGACCTGT CGCCGATCTC TACGGCCCTG CCAGCCAGGA CTCCGGAGTG GGGAATTACA 961 TAAGTGCGGC CAGCCCACAG CCGGGCTCGG GCTTCGGCCA CGGCATAGCT GGACCTTTGA 1021 TTGCAACGGC CTTTACAAAT GGATACCATT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1081 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1141 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGATCT 1201 CGCCGAGCCA AACTTGCCTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1261 tgaaagatt