Transcript: Human NM_001202429.2

Homo sapiens ankyrin repeat and SOCS box containing 2 (ASB2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ASB2 (51676)
Length:
2608
CDS:
211..2118

Additional Resources:

NCBI RefSeq record:
NM_001202429.2
NBCI Gene record:
ASB2 (51676)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001202429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147248 GATACCTGAAATACGAGAACA pLKO.1 2090 CDS 100% 4.950 6.930 N ASB2 n/a
2 TRCN0000183493 GCTGATTAGATACCTGAAATA pLKO.1 2082 CDS 100% 13.200 9.240 N ASB2 n/a
3 TRCN0000178810 CCCTCAGACTCTTCTTACTAA pLKO.1 2146 3UTR 100% 5.625 3.938 N ASB2 n/a
4 TRCN0000147378 GAATGTGTCAAGGAGAAGAAT pLKO.1 2305 3UTR 100% 5.625 3.938 N ASB2 n/a
5 TRCN0000179675 GCAGAGAACAGAATGTGTCAA pLKO.1 2295 3UTR 100% 4.950 3.465 N ASB2 n/a
6 TRCN0000180704 GAAGGAACACATCGACAGCTT pLKO.1 1929 CDS 100% 2.640 1.848 N ASB2 n/a
7 TRCN0000180752 GCAGAAATACAGCAGCAGCTT pLKO.1 480 CDS 100% 2.640 1.848 N ASB2 n/a
8 TRCN0000084620 GCCTCCAAGAAGGGCAACTAT pLKO.1 1240 CDS 100% 5.625 3.938 N Asb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001202429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03364 pDONR223 100% 90.3% 88.6% None (many diffs) n/a
2 ccsbBroad304_03364 pLX_304 0% 90.3% 88.6% V5 (many diffs) n/a
3 TRCN0000471946 CCCCGAAGCGACCCATCTTTTGAC pLX_317 22.6% 90.3% 88.6% V5 (many diffs) n/a
Download CSV