Transcript: Human NM_001206484.3

Homo sapiens activating transcription factor 3 (ATF3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
ATF3 (467)
Length:
1900
CDS:
306..680

Additional Resources:

NCBI RefSeq record:
NM_001206484.3
NBCI Gene record:
ATF3 (467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329690 CTTCATCGGCCCACGTGTATT pLKO_005 576 CDS 100% 13.200 18.480 N ATF3 n/a
2 TRCN0000329691 ACGAGAAGCAGCATTTGATAT pLKO_005 544 CDS 100% 13.200 9.240 N ATF3 n/a
3 TRCN0000329749 AGATGAGAGAAACCTCTTTAT pLKO_005 626 CDS 100% 13.200 9.240 N ATF3 n/a
4 TRCN0000013568 CCGCCTTTCATCTGGATTCTA pLKO.1 963 3UTR 100% 5.625 3.938 N ATF3 n/a
5 TRCN0000013571 CCTGAAGAAGATGAAAGGAAA pLKO.1 381 CDS 100% 4.950 3.465 N ATF3 n/a
6 TRCN0000013572 GCTGAACTGAAGGCTCAGATT pLKO.1 510 CDS 100% 4.950 3.465 N ATF3 n/a
7 TRCN0000329689 GCTGAACTGAAGGCTCAGATT pLKO_005 510 CDS 100% 4.950 3.465 N ATF3 n/a
8 TRCN0000013569 GCATTTGATATACATGCTCAA pLKO.1 554 CDS 100% 4.050 2.835 N ATF3 n/a
9 TRCN0000082132 AGAAGGAACATTGCAGAGCTA pLKO.1 659 CDS 100% 2.640 1.848 N Atf3 n/a
10 TRCN0000301644 AGAAGGAACATTGCAGAGCTA pLKO_005 659 CDS 100% 2.640 1.848 N Atf3 n/a
11 TRCN0000082130 ACCTCTTTATCCAACAGATAA pLKO.1 637 CDS 100% 1.320 0.924 N Atf3 n/a
12 TRCN0000013570 CCTCTTTATCCAACAGATAAA pLKO.1 638 CDS 100% 1.320 0.924 N ATF3 n/a
13 TRCN0000329692 GTTGTGCTTTCTAGCAAATAT pLKO_005 1138 3UTR 100% 15.000 9.000 N ATF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05863 pDONR223 100% 68.3% 67.9% None 0_1ins171;362C>A n/a
2 ccsbBroad304_05863 pLX_304 0% 68.3% 67.9% V5 0_1ins171;362C>A n/a
3 TRCN0000467581 ATCAACAGTCTTACTCATCACACC pLX_317 77% 68.3% 67.9% V5 0_1ins171;362C>A n/a
Download CSV