Transcript: Human NM_001206486.2

Homo sapiens activating transcription factor 3 (ATF3), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-05-19
Taxon:
Homo sapiens (human)
Gene:
ATF3 (467)
Length:
2010
CDS:
5..325

Additional Resources:

NCBI RefSeq record:
NM_001206486.2
NBCI Gene record:
ATF3 (467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329690 CTTCATCGGCCCACGTGTATT pLKO_005 671 3UTR 100% 13.200 18.480 N ATF3 n/a
2 TRCN0000329691 ACGAGAAGCAGCATTTGATAT pLKO_005 639 3UTR 100% 13.200 9.240 N ATF3 n/a
3 TRCN0000329749 AGATGAGAGAAACCTCTTTAT pLKO_005 721 3UTR 100% 13.200 9.240 N ATF3 n/a
4 TRCN0000013568 CCGCCTTTCATCTGGATTCTA pLKO.1 1058 3UTR 100% 5.625 3.938 N ATF3 n/a
5 TRCN0000013571 CCTGAAGAAGATGAAAGGAAA pLKO.1 164 CDS 100% 4.950 3.465 N ATF3 n/a
6 TRCN0000013572 GCTGAACTGAAGGCTCAGATT pLKO.1 605 3UTR 100% 4.950 3.465 N ATF3 n/a
7 TRCN0000329689 GCTGAACTGAAGGCTCAGATT pLKO_005 605 3UTR 100% 4.950 3.465 N ATF3 n/a
8 TRCN0000013569 GCATTTGATATACATGCTCAA pLKO.1 649 3UTR 100% 4.050 2.835 N ATF3 n/a
9 TRCN0000082132 AGAAGGAACATTGCAGAGCTA pLKO.1 754 3UTR 100% 2.640 1.848 N Atf3 n/a
10 TRCN0000301644 AGAAGGAACATTGCAGAGCTA pLKO_005 754 3UTR 100% 2.640 1.848 N Atf3 n/a
11 TRCN0000082130 ACCTCTTTATCCAACAGATAA pLKO.1 732 3UTR 100% 1.320 0.924 N Atf3 n/a
12 TRCN0000013570 CCTCTTTATCCAACAGATAAA pLKO.1 733 3UTR 100% 1.320 0.924 N ATF3 n/a
13 TRCN0000329692 GTTGTGCTTTCTAGCAAATAT pLKO_005 1233 3UTR 100% 15.000 9.000 N ATF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05863 pDONR223 100% 52.6% 50% None (many diffs) n/a
2 ccsbBroad304_05863 pLX_304 0% 52.6% 50% V5 (many diffs) n/a
3 TRCN0000467581 ATCAACAGTCTTACTCATCACACC pLX_317 77% 52.6% 50% V5 (many diffs) n/a
Download CSV