Transcript: Human NM_001242909.2

Homo sapiens R-spondin 1 (RSPO1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RSPO1 (284654)
Length:
2558
CDS:
443..1153

Additional Resources:

NCBI RefSeq record:
NM_001242909.2
NBCI Gene record:
RSPO1 (284654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056679 GACATGAACAAGTGCATCAAA pLKO.1 629 CDS 100% 5.625 3.938 N RSPO1 n/a
2 TRCN0000056681 TGAGCTCTGCTCTGAAGTCAA pLKO.1 493 CDS 100% 4.950 3.465 N RSPO1 n/a
3 TRCN0000056678 CAGCCATAACTTCTGCACCAA pLKO.1 679 CDS 100% 2.640 1.848 N RSPO1 n/a
4 TRCN0000056680 CCTGCTGGAGAGGAACGACAT pLKO.1 547 CDS 100% 1.350 0.945 N RSPO1 n/a
5 TRCN0000056682 TGCTGGCTCTCGAAGACGCAA pLKO.1 1069 CDS 100% 0.880 0.616 N RSPO1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1388 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000178741 CACACACATACACACACACAA pLKO.1 1378 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05385 pDONR223 100% 88.2% 88.2% None (many diffs) n/a
2 ccsbBroad304_05385 pLX_304 0% 88.2% 88.2% V5 (many diffs) n/a
3 TRCN0000469885 TGTCGTATCTACACTTCCGCCGTG pLX_317 49.3% 88.2% 88.2% V5 (many diffs) n/a
Download CSV