Transcript: Human NM_001243795.2

Homo sapiens carbohydrate sulfotransferase 12 (CHST12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CHST12 (55501)
Length:
15971
CDS:
127..1371

Additional Resources:

NCBI RefSeq record:
NM_001243795.2
NBCI Gene record:
CHST12 (55501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035941 CGACGAGTTTCTGGACAAGTT pLKO.1 324 CDS 100% 4.950 6.930 N CHST12 n/a
2 TRCN0000436865 GTGCCAGATCGACTACGACTT pLKO_005 1119 CDS 100% 4.050 5.670 N CHST12 n/a
3 TRCN0000035943 GCAGCTGTATAAACTCTACGA pLKO.1 1296 CDS 100% 2.640 3.696 N CHST12 n/a
4 TRCN0000035942 CGCGCACCTGACCTTCAACAA pLKO.1 759 CDS 100% 1.650 2.310 N CHST12 n/a
5 TRCN0000419854 TTGAGTACTGTATCGATATTG pLKO_005 1489 3UTR 100% 13.200 9.240 N CHST12 n/a
6 TRCN0000424195 TCAGGTATTTAATACGAAATG pLKO_005 1530 3UTR 100% 10.800 7.560 N CHST12 n/a
7 TRCN0000035939 GCTCAAGAAGTACACCAAGTT pLKO.1 828 CDS 100% 4.950 3.465 N CHST12 n/a
8 TRCN0000035940 CGACTTTGTTCTCTTCGGCTA pLKO.1 1320 CDS 100% 2.160 1.512 N CHST12 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 15217 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2044 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 11509 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 15144 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
13 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 10841 3UTR 100% 1.080 0.540 Y GPR83 n/a
14 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 10841 3UTR 100% 1.080 0.540 Y MYORG n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 11510 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2041 3UTR 100% 4.950 2.475 Y LOC339059 n/a
17 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5220 3UTR 100% 4.950 2.475 Y KAAG1 n/a
18 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 7023 3UTR 100% 2.640 1.320 Y LINC01098 n/a
19 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 14978 3UTR 100% 0.495 0.248 Y C11orf44 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3558 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03592 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03592 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480263 ATTAGACCATCAATGAGCTGTCCT pLX_317 28.2% 100% 100% V5 n/a
Download CSV