Transcript: Human NM_001243974.1

Homo sapiens protein phosphatase 3 catalytic subunit gamma (PPP3CC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PPP3CC (5533)
Length:
2361
CDS:
441..2006

Additional Resources:

NCBI RefSeq record:
NM_001243974.1
NBCI Gene record:
PPP3CC (5533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271275 GCGAGGTCTGGACCGAATTAA pLKO_005 1868 CDS 100% 15.000 21.000 N PPP3CC n/a
2 TRCN0000381133 GTCCGAGGGTGCTCTTATTTC pLKO_005 1185 CDS 100% 13.200 18.480 N PPP3CC n/a
3 TRCN0000320437 ACGCTGGTGGGCCAATGAAAT pLKO_005 1921 CDS 100% 13.200 10.560 N PPP3CC n/a
4 TRCN0000006878 GCAGGCATCTTACAGACTATT pLKO.1 886 CDS 100% 13.200 10.560 N PPP3CC n/a
5 TRCN0000377243 GTTGGAGGATCACCTAGTAAC pLKO_005 738 CDS 100% 10.800 8.640 N PPP3CC n/a
6 TRCN0000006877 CGGCTTACTTTCAAGGAAGTA pLKO.1 513 CDS 100% 0.495 0.396 N PPP3CC n/a
7 TRCN0000271274 CGTGGCTCAGGTGGATCTAAA pLKO_005 2020 3UTR 100% 13.200 9.240 N PPP3CC n/a
8 TRCN0000271276 GGACAATTCTTTGACCTAATG pLKO_005 705 CDS 100% 10.800 7.560 N PPP3CC n/a
9 TRCN0000006875 CAGTCTGCATTTATTCTGTAA pLKO.1 2125 3UTR 100% 4.950 3.465 N PPP3CC n/a
10 TRCN0000006879 CCCAATTACCTAGATGTCTAT pLKO.1 1353 CDS 100% 4.950 3.465 N PPP3CC n/a
11 TRCN0000006876 GCCCTCTTAAACCAGCAGTTT pLKO.1 993 CDS 100% 4.950 3.465 N PPP3CC n/a
12 TRCN0000271212 TGGTAAATGTGCTCAACATAT pLKO_005 1522 CDS 100% 13.200 7.920 N PPP3CC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06761 pDONR223 100% 98.2% 98.2% None 1139_1165del;1551G>A n/a
2 ccsbBroad304_06761 pLX_304 0% 98.2% 98.2% V5 1139_1165del;1551G>A n/a
3 TRCN0000475207 ACGACCATGATACGACGGACCGAT pLX_317 21.2% 98.2% 98.2% V5 1139_1165del;1551G>A n/a
Download CSV