Transcript: Human NM_001244644.2

Homo sapiens charged multivesicular body protein 2B (CHMP2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CHMP2B (25978)
Length:
2498
CDS:
246..764

Additional Resources:

NCBI RefSeq record:
NM_001244644.2
NBCI Gene record:
CHMP2B (25978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001244644.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436014 ATACACTTGATGACATCTTTG pLKO_005 553 CDS 100% 10.800 15.120 N CHMP2B n/a
2 TRCN0000131086 GCTTACCATCTGCCTCTACTT pLKO.1 682 CDS 100% 4.950 3.960 N CHMP2B n/a
3 TRCN0000349688 GCTTACCATCTGCCTCTACTT pLKO_005 682 CDS 100% 4.950 3.960 N CHMP2B n/a
4 TRCN0000129379 GAAGCTTACCATCTGCCTCTA pLKO.1 679 CDS 100% 4.050 3.240 N CHMP2B n/a
5 TRCN0000130897 GCTTGACACCTGCCTTAAATA pLKO.1 1352 3UTR 100% 15.000 10.500 N CHMP2B n/a
6 TRCN0000379656 CAAGGCTTTAGGAGTAGATTA pLKO_005 743 CDS 100% 13.200 9.240 N CHMP2B n/a
7 TRCN0000370533 TACTTCTATGTCTACACAAAC pLKO_005 368 CDS 100% 10.800 7.560 N CHMP2B n/a
8 TRCN0000130815 GCCTTAAATAGCACAGACCTA pLKO.1 1363 3UTR 100% 2.640 1.848 N CHMP2B n/a
9 TRCN0000319392 GCCTTAAATAGCACAGACCTA pLKO_005 1363 3UTR 100% 2.640 1.848 N CHMP2B n/a
10 TRCN0000241152 TGACTGAAGAAATGATCAATG pLKO_005 532 CDS 100% 10.800 6.480 N Chmp2b n/a
11 TRCN0000128433 GCAGTTAACAAGAAGATGGAT pLKO.1 453 CDS 100% 3.000 1.800 N CHMP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244644.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07972 pDONR223 100% 80.4% 80.2% None 1_1delAins124;189T>C n/a
2 ccsbBroad304_07972 pLX_304 0% 80.4% 80.2% V5 1_1delAins124;189T>C n/a
3 TRCN0000479680 TCCGGCCTACTACTCTTCTAATAC pLX_317 64.1% 80.4% 80.2% V5 1_1delAins124;189T>C n/a
Download CSV