Transcript: Human NM_001244962.2

Homo sapiens FERM domain containing 3 (FRMD3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
FRMD3 (257019)
Length:
943
CDS:
92..733

Additional Resources:

NCBI RefSeq record:
NM_001244962.2
NBCI Gene record:
FRMD3 (257019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001244962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16137 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16137 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479067 CGACCCCTCCCCAGTTATGTTCCA pLX_317 71.5% 99.8% 34.7% V5 (not translated due to prior stop codon) 217_218insC n/a
4 ccsbBroadEn_13478 pDONR223 100% 33.1% 28.3% None (many diffs) n/a
5 ccsbBroad304_13478 pLX_304 0% 33.1% 28.3% V5 (many diffs) n/a
6 TRCN0000492301 AGGTTAACTCATATGTTAACTCGG pLX_317 21.7% 33.1% 28.3% V5 (many diffs) n/a
Download CSV