Transcript: Mouse NM_001252218.1

Mus musculus ribosomal protein L31 (Rpl31), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rpl31 (114641)
Length:
1261
CDS:
299..676

Additional Resources:

NCBI RefSeq record:
NM_001252218.1
NBCI Gene record:
Rpl31 (114641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104235 CCTCCCTAGTATTGGCAATTA pLKO.1 960 3UTR 100% 13.200 9.240 N Rpl31 n/a
2 TRCN0000435899 GAAATTAGAAATACGTGAAAC pLKO_005 813 3UTR 100% 10.800 7.560 N Rpl31 n/a
3 TRCN0000440448 GGTCTACAGGGTGTTGGAAAT pLKO_005 761 3UTR 100% 10.800 7.560 N Rpl31 n/a
4 TRCN0000104237 CCTCGGGCACTCAAAGAAATT pLKO.1 425 CDS 100% 13.200 6.600 Y Rpl31 n/a
5 TRCN0000104236 CGTGCCTGTTACCACATTCAA pLKO.1 622 CDS 100% 5.625 2.813 Y Rpl31 n/a
6 TRCN0000075039 CCGAGAATACACCATCAACAT pLKO.1 364 CDS 100% 4.950 2.475 Y RPL31 n/a
7 TRCN0000104239 CGGAAGTTTGCCATGAAGGAA pLKO.1 446 CDS 100% 3.000 1.500 Y Rpl31 n/a
8 TRCN0000104238 GCCAAGGGAATAAGGAACGTT pLKO.1 518 CDS 100% 3.000 1.500 Y Rpl31 n/a
9 TRCN0000075041 GCGCATTGACACCAGGCTCAA pLKO.1 484 CDS 100% 1.350 0.675 Y RPL31 n/a
10 TRCN0000307902 GCGCATTGACACCAGGCTCAA pLKO_005 484 CDS 100% 1.350 0.675 Y RPL31 n/a
11 TRCN0000188224 CCATCAACATTCACAAGCGCA pLKO.1 375 CDS 100% 0.660 0.330 Y RPL31P50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01433 pDONR223 100% 90.9% 100% None (many diffs) n/a
2 ccsbBroad304_01433 pLX_304 0% 90.9% 100% V5 (many diffs) n/a
3 TRCN0000468634 ACAACCATTAGTATCTCTTACACA pLX_317 100% 90.9% 100% V5 (many diffs) n/a
Download CSV