Transcript: Mouse NM_001252580.1

Mus musculus ubiquitin specific peptidase 8 (Usp8), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Usp8 (84092)
Length:
4210
CDS:
227..3502

Additional Resources:

NCBI RefSeq record:
NM_001252580.1
NBCI Gene record:
Usp8 (84092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312961 CAATAAGAAGACCGAAGTTAA pLKO_005 286 CDS 100% 13.200 18.480 N Usp8 n/a
2 TRCN0000030746 CCAAAGGATTAACGGCGAGAA pLKO.1 751 CDS 100% 4.050 5.670 N Usp8 n/a
3 TRCN0000030748 CGGAACCTCAATCCTGTATTT pLKO.1 2432 CDS 100% 13.200 10.560 N Usp8 n/a
4 TRCN0000313005 GACCTGTCACAGTACGTTATT pLKO_005 3251 CDS 100% 13.200 10.560 N Usp8 n/a
5 TRCN0000030744 CCTCACATCTAATGCTTACAA pLKO.1 3545 3UTR 100% 5.625 4.500 N Usp8 n/a
6 TRCN0000311935 CCTCACATCTAATGCTTACAA pLKO_005 3545 3UTR 100% 5.625 4.500 N Usp8 n/a
7 TRCN0000030745 CGCAGTTTACAACCAATGCTA pLKO.1 1185 CDS 100% 3.000 2.400 N Usp8 n/a
8 TRCN0000349844 CAGGACTGCCTTAGATTATTT pLKO_005 3038 CDS 100% 15.000 10.500 N Usp8 n/a
9 TRCN0000312962 TCTTACTGGACTTCGTAATTT pLKO_005 2470 CDS 100% 15.000 10.500 N Usp8 n/a
10 TRCN0000030747 GCTGCAAACATCCGTGGATTT pLKO.1 3214 CDS 100% 10.800 7.560 N Usp8 n/a
11 TRCN0000272433 TCAAGCAACAGCAGGATTATT pLKO_005 495 CDS 100% 15.000 9.000 N USP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02081 pDONR223 100% 80.9% 81% None (many diffs) n/a
2 ccsbBroad304_02081 pLX_304 0% 80.9% 81% V5 (many diffs) n/a
3 TRCN0000466074 AAAGAAGACGGCCCAATGCCACAC pLX_317 10.5% 80.9% 81% V5 (many diffs) n/a
Download CSV