Transcript: Mouse NM_001252620.1

Mus musculus sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3 (Spock3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Spock3 (72902)
Length:
3112
CDS:
71..1381

Additional Resources:

NCBI RefSeq record:
NM_001252620.1
NBCI Gene record:
Spock3 (72902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443369 GATGTCCATGATGGATATATT pLKO_005 1358 CDS 100% 15.000 21.000 N Spock3 n/a
2 TRCN0000453163 CAAGACTTATAGTTGGTATTT pLKO_005 1839 3UTR 100% 13.200 18.480 N Spock3 n/a
3 TRCN0000451345 ACCCATGCTTAAAGACGAAAT pLKO_005 333 CDS 100% 10.800 15.120 N Spock3 n/a
4 TRCN0000080271 CTTGGGAGCATATACCTTGAT pLKO.1 887 CDS 100% 4.950 6.930 N Spock3 n/a
5 TRCN0000373575 ACGAAGTAGAGGATGATTATT pLKO_005 258 CDS 100% 15.000 10.500 N SPOCK3 n/a
6 TRCN0000446129 ACGAAGTAGAGGATGATTATT pLKO_005 258 CDS 100% 15.000 10.500 N Spock3 n/a
7 TRCN0000080268 CCCTAAACAAAGTGGTTCTAA pLKO.1 1460 3UTR 100% 5.625 3.938 N Spock3 n/a
8 TRCN0000080272 AGCCGCCACAAAGTTTGCATT pLKO.1 356 CDS 100% 4.950 3.465 N Spock3 n/a
9 TRCN0000080269 GCTCACGACAATCTCTCAGTA pLKO.1 202 CDS 100% 4.950 3.465 N Spock3 n/a
10 TRCN0000080270 GCAAACTAGAATATCAGGCAT pLKO.1 555 CDS 100% 2.640 1.848 N Spock3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03159 pDONR223 100% 88.8% 89.4% None (many diffs) n/a
2 ccsbBroad304_03159 pLX_304 0% 88.8% 89.4% V5 (many diffs) n/a
3 TRCN0000466713 CAGATAGTCCCGAGAGCACTGCGA pLX_317 36.7% 88.8% 89.4% V5 (many diffs) n/a
4 ccsbBroadEn_15815 pDONR223 0% 88.7% 89.4% None (many diffs) n/a
5 ccsbBroad304_15815 pLX_304 0% 88.7% 89.4% V5 (many diffs) n/a
6 TRCN0000465485 AAACATGAGATCAGGTGTTCACAT pLX_317 30.6% 88.7% 89.4% V5 (many diffs) n/a
Download CSV