Transcript: Human NM_001253387.1

Homo sapiens cell adhesion molecule L1 like (CHL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
CHL1 (10752)
Length:
7983
CDS:
643..4269

Additional Resources:

NCBI RefSeq record:
NM_001253387.1
NBCI Gene record:
CHL1 (10752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001253387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000449595 CAGCAATATTAGCGAGTATAT pLKO_005 2559 CDS 100% 13.200 18.480 N CHL1 n/a
2 TRCN0000073447 GCTGCCGATATAACTCAAGTA pLKO.1 2440 CDS 100% 4.950 6.930 N CHL1 n/a
3 TRCN0000073446 CGCAATGACTACTGTTGCTTT pLKO.1 1237 CDS 100% 4.950 3.960 N CHL1 n/a
4 TRCN0000073444 CGTCCATTGATACAAACCAAA pLKO.1 1906 CDS 100% 4.950 3.960 N CHL1 n/a
5 TRCN0000073445 CCATTGATACAAACCAAAGAT pLKO.1 1909 CDS 100% 5.625 3.938 N CHL1 n/a
6 TRCN0000073443 CCAGAATGTATAGACAGGAAA pLKO.1 5949 3UTR 100% 4.950 3.465 N CHL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11544 pDONR223 100% 99.9% 99.8% None 859A>G;3100A>G;3165T>C n/a
2 ccsbBroad304_11544 pLX_304 0% 99.9% 99.8% V5 859A>G;3100A>G;3165T>C n/a
3 TRCN0000479321 TGAAATTTGTTCCCACTCAGCATT pLX_317 13.6% 99.9% 99.8% V5 859A>G;3100A>G;3165T>C n/a
Download CSV