Transcript: Human NM_001254748.1

Homo sapiens regulator of G protein signaling 5 (RGS5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
RGS5 (8490)
Length:
5822
CDS:
548..769

Additional Resources:

NCBI RefSeq record:
NM_001254748.1
NBCI Gene record:
RGS5 (8490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001254748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014317 GACCTTGTCATTCCGTACAAT pLKO.1 326 5UTR 100% 5.625 7.875 N RGS5 n/a
2 TRCN0000342798 GACCTTGTCATTCCGTACAAT pLKO_005 326 5UTR 100% 5.625 7.875 N RGS5 n/a
3 TRCN0000014316 ACAACTATGGACTTGCCAGTT pLKO.1 435 5UTR 100% 4.050 3.240 N RGS5 n/a
4 TRCN0000352786 ACAACTATGGACTTGCCAGTT pLKO_005 435 5UTR 100% 4.050 3.240 N RGS5 n/a
5 TRCN0000014314 GCTCCTAAAGAGGTGAATATT pLKO.1 596 CDS 100% 15.000 10.500 N RGS5 n/a
6 TRCN0000014315 CAAGGAGATTAAGATCAAGTT pLKO.1 271 5UTR 100% 4.950 3.465 N RGS5 n/a
7 TRCN0000014313 CCTCCATAATAACCCTGCATT pLKO.1 809 3UTR 100% 4.950 3.465 N RGS5 n/a
8 TRCN0000342799 CCTCCATAATAACCCTGCATT pLKO_005 809 3UTR 100% 4.950 3.465 N RGS5 n/a
9 TRCN0000433144 GAGAAGGCAAAGCAAATTTAT pLKO_005 554 CDS 100% 15.000 9.000 N Rgs5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001254748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01939 pDONR223 100% 40.3% 40.3% None 0_1ins324 n/a
2 ccsbBroad304_01939 pLX_304 0% 40.3% 40.3% V5 0_1ins324 n/a
3 TRCN0000472811 CCGTGGCAACTTCTTCCTGTGAAA pLX_317 81.8% 40.3% 40.3% V5 0_1ins324 n/a
Download CSV