Transcript: Human NM_001256071.3

Homo sapiens ring finger protein 213 (RNF213), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
RNF213 (57674)
Length:
21079
CDS:
160..15783

Additional Resources:

NCBI RefSeq record:
NM_001256071.3
NBCI Gene record:
RNF213 (57674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019041 CCTTACAAGTACGTCATTTAT pLKO.1 1504 CDS 100% 15.000 21.000 N RNF213 n/a
2 TRCN0000151569 GCAAGAGATCTTTGGATGTTT pLKO.1 11140 CDS 100% 5.625 7.875 N RNF213 n/a
3 TRCN0000153221 GCCTCAGCTAAGTATTCTGTT pLKO.1 10333 CDS 100% 4.950 3.960 N RNF213 n/a
4 TRCN0000153317 GCCTTAAACAGATGCCAGTTA pLKO.1 15355 CDS 100% 4.950 3.960 N RNF213 n/a
5 TRCN0000153281 GCACAACTCCTTTGCAGATTT pLKO.1 10035 CDS 100% 13.200 9.240 N RNF213 n/a
6 TRCN0000019039 GCAGAATGATTAGACTTCTAT pLKO.1 2786 CDS 100% 5.625 3.938 N RNF213 n/a
7 TRCN0000153222 GCAGATGTGCAACAGTTTCTT pLKO.1 12345 CDS 100% 5.625 3.938 N RNF213 n/a
8 TRCN0000019040 GCTCAGACAGTTGGCAAGAAA pLKO.1 356 CDS 100% 5.625 3.938 N RNF213 n/a
9 TRCN0000156905 GCTCTCGTCAGCTACTTGATT pLKO.1 14803 CDS 100% 5.625 3.938 N RNF213 n/a
10 TRCN0000151831 CCTGATTGTCATTGAAGAGAA pLKO.1 9600 CDS 100% 4.950 3.465 N RNF213 n/a
11 TRCN0000019043 CGATTTGCAGTACAGGGAGAA pLKO.1 1890 CDS 100% 4.050 2.835 N RNF213 n/a
12 TRCN0000157222 GCTGACAAGAAACACCCTGAA pLKO.1 11766 CDS 100% 4.050 2.835 N RNF213 n/a
13 TRCN0000153316 GCAAGTTGAATACAGCTCCAT pLKO.1 14565 CDS 100% 2.640 1.848 N RNF213 n/a
14 TRCN0000150582 GCTGAAATGGAATCGAGAAAT pLKO.1 15756 CDS 100% 13.200 7.920 N RNF213 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08756 pDONR223 100% 20.1% 19.6% None (many diffs) n/a
2 ccsbBroad304_08756 pLX_304 0% 20.1% 19.6% V5 (many diffs) n/a
3 TRCN0000478695 GAGCTGGGGACCGAGGGTTTTGCA pLX_317 11.1% 20.1% 19.6% V5 (many diffs) n/a
4 ccsbBroadEn_14234 pDONR223 100% 9.7% 9.7% None 1_14094del;15617T>C n/a
5 ccsbBroad304_14234 pLX_304 0% 9.7% 9.7% V5 1_14094del;15617T>C n/a
6 TRCN0000467930 TTTCGTATACAAAATACCATCATC pLX_317 28.1% 9.7% 9.7% V5 1_14094del;15617T>C n/a
Download CSV